Incidental Mutation 'PIT4449001:Dhx15'
ID555728
Institutional Source Beutler Lab
Gene Symbol Dhx15
Ensembl Gene ENSMUSG00000029169
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 15
SynonymsDdx15, HRH2, DBP1, mDEAH9
Accession Numbers

Genbank: NM_001042620, NM_007839; MGI: 1099786

Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #PIT4449001 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location52150203-52190514 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52160958 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 510 (V510A)
Ref Sequence ENSEMBL: ENSMUSP00000031061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031061] [ENSMUST00000199321] [ENSMUST00000200186]
Predicted Effect probably damaging
Transcript: ENSMUST00000031061
AA Change: V510A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031061
Gene: ENSMUSG00000029169
AA Change: V510A

DomainStartEndE-ValueType
low complexity region 23 60 N/A INTRINSIC
low complexity region 79 110 N/A INTRINSIC
DEXDc 135 322 4.11e-32 SMART
AAA 152 326 1.07e-2 SMART
HELICc 363 477 1.06e-16 SMART
HA2 538 628 2.76e-31 SMART
Pfam:OB_NTP_bind 662 765 3.1e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199321
AA Change: V510A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143069
Gene: ENSMUSG00000029169
AA Change: V510A

DomainStartEndE-ValueType
low complexity region 23 60 N/A INTRINSIC
low complexity region 79 110 N/A INTRINSIC
DEXDc 135 322 4.11e-32 SMART
AAA 152 326 1.07e-2 SMART
HELICc 363 477 1.06e-16 SMART
HA2 538 628 2.76e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000200186
AA Change: V510A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143381
Gene: ENSMUSG00000029169
AA Change: V510A

DomainStartEndE-ValueType
low complexity region 23 60 N/A INTRINSIC
low complexity region 79 110 N/A INTRINSIC
DEXDc 135 322 1.7e-34 SMART
AAA 152 326 1.7e-4 SMART
HELICc 363 477 4.3e-19 SMART
HA2 538 608 4.6e-20 SMART
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative ATP-dependent RNA helicase implicated in pre-mRNA splicing. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(24) : Gene trapped(24)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asf1b A G 8: 83,967,982 N125S probably benign Het
BC048671 T A 6: 90,305,163 L101I probably damaging Het
Camta1 A G 4: 151,131,586 L959P probably benign Het
Cfh C A 1: 140,112,565 V598F probably damaging Het
Cyp2j7 G T 4: 96,215,338 T320K probably damaging Het
Ddr1 A G 17: 35,687,249 I468T possibly damaging Het
Dpp4 T A 2: 62,356,644 K507N probably benign Het
Evpl G A 11: 116,233,399 T198M possibly damaging Het
Gabbr1 G A 17: 37,056,350 V373I probably damaging Het
Gak A T 5: 108,580,925 S1049T probably benign Het
Gipr C T 7: 19,160,618 R253H probably benign Het
Gm3685 T A 14: 7,043,960 M73L probably benign Het
Gm5168 C T X: 26,039,540 R129Q probably null Het
Kcnh1 T A 1: 192,418,684 V555D probably damaging Het
Kif26b T C 1: 178,918,086 S1916P probably damaging Het
Lingo4 T C 3: 94,401,932 V59A probably benign Het
Maats1 T C 16: 38,328,358 E236G probably damaging Het
Mroh8 T A 2: 157,225,534 Q635L probably damaging Het
Msh6 T A 17: 87,986,188 D790E probably damaging Het
Nrxn1 A T 17: 90,597,579 W809R probably damaging Het
Olfr201 C A 16: 59,269,130 C179F probably damaging Het
Polr3d T C 14: 70,439,463 H397R probably benign Het
Pwp2 G A 10: 78,178,470 T432I probably benign Het
Rad21 G C 15: 51,973,243 F177L probably benign Het
Rnf182 G A 13: 43,668,677 V235I probably benign Het
Scn11a C T 9: 119,769,948 C1172Y probably damaging Het
Sh2b3 A G 5: 121,828,679 L124P possibly damaging Het
Six2 T C 17: 85,685,478 N199S probably benign Het
Slc5a3 A G 16: 92,077,814 D253G probably benign Het
Synm A G 7: 67,735,277 M879T probably benign Het
Tasp1 A G 2: 139,910,535 I328T possibly damaging Het
Tbrg4 T C 11: 6,619,689 Q309R probably damaging Het
Tcrg-C3 A T 13: 19,263,362 R162* probably null Het
Tmtc2 A G 10: 105,303,604 L687P probably damaging Het
Tufm T C 7: 126,487,449 M1T probably null Het
Vmn2r116 A C 17: 23,388,947 L496F probably benign Het
Vmn2r75 C T 7: 86,165,583 C234Y probably damaging Het
Wars2 G T 3: 99,205,279 V162L possibly damaging Het
Zc3h11a A T 1: 133,624,611 V586D probably benign Het
Zdhhc5 A T 2: 84,690,227 N535K probably damaging Het
Zfp52 T C 17: 21,557,216 Y38H probably damaging Het
Zfp729b T C 13: 67,591,423 M908V probably benign Het
Zfp772 T C 7: 7,204,351 I114V probably benign Het
Other mutations in Dhx15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Dhx15 APN 5 52166775 missense probably damaging 1.00
IGL00392:Dhx15 APN 5 52157582 splice site probably benign
IGL00484:Dhx15 APN 5 52166812 missense probably benign
IGL00691:Dhx15 APN 5 52170093 missense probably damaging 1.00
IGL01014:Dhx15 APN 5 52151924 missense probably damaging 1.00
IGL02808:Dhx15 APN 5 52161699 missense possibly damaging 0.95
IGL03408:Dhx15 APN 5 52160312 missense probably damaging 1.00
3-1:Dhx15 UTSW 5 52166697 splice site probably benign
R0021:Dhx15 UTSW 5 52157488 missense probably damaging 0.98
R0133:Dhx15 UTSW 5 52154072 missense possibly damaging 0.61
R0281:Dhx15 UTSW 5 52150746 missense probably benign 0.10
R0566:Dhx15 UTSW 5 52171425 missense probably damaging 1.00
R1827:Dhx15 UTSW 5 52170080 nonsense probably null
R1864:Dhx15 UTSW 5 52184701 missense possibly damaging 0.53
R2106:Dhx15 UTSW 5 52170086 missense probably benign 0.00
R2931:Dhx15 UTSW 5 52166732 missense probably benign 0.01
R2932:Dhx15 UTSW 5 52166732 missense probably benign 0.01
R3762:Dhx15 UTSW 5 52166732 missense probably benign 0.01
R3764:Dhx15 UTSW 5 52166732 missense probably benign 0.01
R3948:Dhx15 UTSW 5 52161580 splice site probably benign
R4452:Dhx15 UTSW 5 52166732 missense probably benign 0.01
R5068:Dhx15 UTSW 5 52170067 missense possibly damaging 0.59
R7031:Dhx15 UTSW 5 52184589 missense probably benign 0.03
R7431:Dhx15 UTSW 5 52162611 missense probably damaging 1.00
X0017:Dhx15 UTSW 5 52157490 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATTTTAGTGCAGAGTGGAAGC -3'
(R):5'- AAGTGCCTTAACTTTGCCCC -3'

Sequencing Primer
(F):5'- AGCAAAAGGTAAGTGTACTTAATGC -3'
(R):5'- TAACATGCGCGTTTCCT -3'
Posted On2019-06-07