Incidental Mutation 'PIT4449001:Sh2b3'
ID555730
Institutional Source Beutler Lab
Gene Symbol Sh2b3
Ensembl Gene ENSMUSG00000042594
Gene NameSH2B adaptor protein 3
SynonymsLnk
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.625) question?
Stock #PIT4449001 (G1)
Quality Score98.0078
Status Not validated
Chromosome5
Chromosomal Location121815488-121837646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121828679 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 124 (L124P)
Ref Sequence ENSEMBL: ENSMUSP00000041611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040308] [ENSMUST00000086310] [ENSMUST00000118580] [ENSMUST00000122426] [ENSMUST00000136960] [ENSMUST00000137682] [ENSMUST00000197892]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040308
AA Change: L124P

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000041611
Gene: ENSMUSG00000042594
AA Change: L124P

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Pfam:Phe_ZIP 23 76 1.1e-20 PFAM
low complexity region 114 128 N/A INTRINSIC
PH 168 281 1.2e-2 SMART
SH2 334 419 3.53e-19 SMART
low complexity region 512 525 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000086310
AA Change: L124P

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000083490
Gene: ENSMUSG00000042594
AA Change: L124P

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Pfam:Phe_ZIP 22 77 2e-22 PFAM
low complexity region 114 128 N/A INTRINSIC
PH 168 281 1.2e-2 SMART
SH2 334 419 3.53e-19 SMART
low complexity region 512 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118580
AA Change: L124P

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000113808
Gene: ENSMUSG00000042594
AA Change: L124P

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Pfam:Phe_ZIP 22 77 4.1e-23 PFAM
low complexity region 114 128 N/A INTRINSIC
PH 168 281 1.2e-2 SMART
SH2 324 409 3.53e-19 SMART
low complexity region 502 515 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000122426
AA Change: L124P

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113926
Gene: ENSMUSG00000042594
AA Change: L124P

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Pfam:Phe_ZIP 22 77 2e-22 PFAM
low complexity region 114 128 N/A INTRINSIC
PH 168 281 1.2e-2 SMART
SH2 334 419 3.53e-19 SMART
low complexity region 512 525 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136960
AA Change: L124P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000119086
Gene: ENSMUSG00000042594
AA Change: L124P

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Pfam:Phe_ZIP 22 77 2.4e-23 PFAM
low complexity region 114 128 N/A INTRINSIC
PH 168 281 1.2e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000137682
AA Change: L124P

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118523
Gene: ENSMUSG00000042594
AA Change: L124P

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Pfam:Phe_ZIP 22 77 2e-23 PFAM
low complexity region 114 128 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000197892
AA Change: L124P

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142666
Gene: ENSMUSG00000042594
AA Change: L124P

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Pfam:Phe_ZIP 22 77 6.3e-20 PFAM
low complexity region 114 128 N/A INTRINSIC
Blast:PH 168 250 3e-53 BLAST
PDB:1V5M|A 171 250 1e-12 PDB
Predicted Effect unknown
Transcript: ENSMUST00000198161
AA Change: S21P
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the SH2B family of adapter proteins that play an important role in T cell receptor signaling. This gene is preferentially expressed in hematopoietic stem cells, hematopoietic progenitors, pre and immature B cells, as well as megakaryocytes and mastocytes. In hematopoietic stem cells, the encoded protein is a key regulator of self-renewal, proliferation and apoptosis. Mice lacking the encoded protein exhibit pre and immature B cell expansion in spleen and the bone marrow. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit severe perturbations in hematopoiesis, splenomegaly, and abnormal lymphoid and myeloid homeostasis. Mice homozygous for a different knock-out allele display altered mobility of hematopoietic stem/progenitor cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asf1b A G 8: 83,967,982 N125S probably benign Het
BC048671 T A 6: 90,305,163 L101I probably damaging Het
Camta1 A G 4: 151,131,586 L959P probably benign Het
Cfh C A 1: 140,112,565 V598F probably damaging Het
Cyp2j7 G T 4: 96,215,338 T320K probably damaging Het
Ddr1 A G 17: 35,687,249 I468T possibly damaging Het
Dhx15 A G 5: 52,160,958 V510A probably damaging Het
Dpp4 T A 2: 62,356,644 K507N probably benign Het
Evpl G A 11: 116,233,399 T198M possibly damaging Het
Gabbr1 G A 17: 37,056,350 V373I probably damaging Het
Gak A T 5: 108,580,925 S1049T probably benign Het
Gipr C T 7: 19,160,618 R253H probably benign Het
Gm3685 T A 14: 7,043,960 M73L probably benign Het
Gm5168 C T X: 26,039,540 R129Q probably null Het
Kcnh1 T A 1: 192,418,684 V555D probably damaging Het
Kif26b T C 1: 178,918,086 S1916P probably damaging Het
Lingo4 T C 3: 94,401,932 V59A probably benign Het
Maats1 T C 16: 38,328,358 E236G probably damaging Het
Mroh8 T A 2: 157,225,534 Q635L probably damaging Het
Msh6 T A 17: 87,986,188 D790E probably damaging Het
Nrxn1 A T 17: 90,597,579 W809R probably damaging Het
Olfr201 C A 16: 59,269,130 C179F probably damaging Het
Polr3d T C 14: 70,439,463 H397R probably benign Het
Pwp2 G A 10: 78,178,470 T432I probably benign Het
Rad21 G C 15: 51,973,243 F177L probably benign Het
Rnf182 G A 13: 43,668,677 V235I probably benign Het
Scn11a C T 9: 119,769,948 C1172Y probably damaging Het
Six2 T C 17: 85,685,478 N199S probably benign Het
Slc5a3 A G 16: 92,077,814 D253G probably benign Het
Synm A G 7: 67,735,277 M879T probably benign Het
Tasp1 A G 2: 139,910,535 I328T possibly damaging Het
Tbrg4 T C 11: 6,619,689 Q309R probably damaging Het
Tcrg-C3 A T 13: 19,263,362 R162* probably null Het
Tmtc2 A G 10: 105,303,604 L687P probably damaging Het
Tufm T C 7: 126,487,449 M1T probably null Het
Vmn2r116 A C 17: 23,388,947 L496F probably benign Het
Vmn2r75 C T 7: 86,165,583 C234Y probably damaging Het
Wars2 G T 3: 99,205,279 V162L possibly damaging Het
Zc3h11a A T 1: 133,624,611 V586D probably benign Het
Zdhhc5 A T 2: 84,690,227 N535K probably damaging Het
Zfp52 T C 17: 21,557,216 Y38H probably damaging Het
Zfp729b T C 13: 67,591,423 M908V probably benign Het
Zfp772 T C 7: 7,204,351 I114V probably benign Het
Other mutations in Sh2b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02283:Sh2b3 APN 5 121818655 missense probably benign 0.09
IGL02328:Sh2b3 APN 5 121817859 missense probably benign 0.00
R0164:Sh2b3 UTSW 5 121829037 missense probably damaging 0.97
R0164:Sh2b3 UTSW 5 121829037 missense probably damaging 0.97
R2898:Sh2b3 UTSW 5 121829048 start codon destroyed probably null 0.93
R4374:Sh2b3 UTSW 5 121828486 unclassified probably benign
R4688:Sh2b3 UTSW 5 121818634 missense probably benign 0.23
R4822:Sh2b3 UTSW 5 121828555 unclassified probably benign
R5743:Sh2b3 UTSW 5 121828457 missense probably damaging 1.00
R5888:Sh2b3 UTSW 5 121829021 missense possibly damaging 0.73
R6130:Sh2b3 UTSW 5 121815563 splice site probably null
R6167:Sh2b3 UTSW 5 121828355 splice site probably null
R6413:Sh2b3 UTSW 5 121828923 missense probably damaging 1.00
R7499:Sh2b3 UTSW 5 121818473 missense probably damaging 0.97
R7615:Sh2b3 UTSW 5 121818700 missense probably benign 0.00
R7672:Sh2b3 UTSW 5 121818759 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGTAGCACCACACTCTCCAG -3'
(R):5'- CCAGTACTGGTTGTTTGCGC -3'

Sequencing Primer
(F):5'- TCACCTTGGGCGGATCGAAG -3'
(R):5'- ACCTGGTGTCGCTGCAGTTC -3'
Posted On2019-06-07