Incidental Mutation 'PIT4449001:Zfp772'
ID555732
Institutional Source Beutler Lab
Gene Symbol Zfp772
Ensembl Gene ENSMUSG00000066838
Gene Namezinc finger protein 772
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #PIT4449001 (G1)
Quality Score209.009
Status Not validated
Chromosome7
Chromosomal Location7202117-7209998 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7204351 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 114 (I114V)
Ref Sequence ENSEMBL: ENSMUSP00000074055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074455]
Predicted Effect probably benign
Transcript: ENSMUST00000074455
AA Change: I114V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000074055
Gene: ENSMUSG00000066838
AA Change: I114V

DomainStartEndE-ValueType
KRAB 42 102 1.87e-14 SMART
ZnF_C2H2 193 215 1.36e-2 SMART
ZnF_C2H2 221 243 5.21e-4 SMART
ZnF_C2H2 249 271 1.38e-3 SMART
ZnF_C2H2 277 299 4.24e-4 SMART
ZnF_C2H2 305 327 5.21e-4 SMART
ZnF_C2H2 333 355 2.27e-4 SMART
ZnF_C2H2 361 383 1.18e-2 SMART
ZnF_C2H2 389 411 4.87e-4 SMART
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asf1b A G 8: 83,967,982 N125S probably benign Het
BC048671 T A 6: 90,305,163 L101I probably damaging Het
Camta1 A G 4: 151,131,586 L959P probably benign Het
Cfh C A 1: 140,112,565 V598F probably damaging Het
Cyp2j7 G T 4: 96,215,338 T320K probably damaging Het
Ddr1 A G 17: 35,687,249 I468T possibly damaging Het
Dhx15 A G 5: 52,160,958 V510A probably damaging Het
Dpp4 T A 2: 62,356,644 K507N probably benign Het
Evpl G A 11: 116,233,399 T198M possibly damaging Het
Gabbr1 G A 17: 37,056,350 V373I probably damaging Het
Gak A T 5: 108,580,925 S1049T probably benign Het
Gipr C T 7: 19,160,618 R253H probably benign Het
Gm3685 T A 14: 7,043,960 M73L probably benign Het
Gm5168 C T X: 26,039,540 R129Q probably null Het
Kcnh1 T A 1: 192,418,684 V555D probably damaging Het
Kif26b T C 1: 178,918,086 S1916P probably damaging Het
Lingo4 T C 3: 94,401,932 V59A probably benign Het
Maats1 T C 16: 38,328,358 E236G probably damaging Het
Mroh8 T A 2: 157,225,534 Q635L probably damaging Het
Msh6 T A 17: 87,986,188 D790E probably damaging Het
Nrxn1 A T 17: 90,597,579 W809R probably damaging Het
Olfr201 C A 16: 59,269,130 C179F probably damaging Het
Polr3d T C 14: 70,439,463 H397R probably benign Het
Pwp2 G A 10: 78,178,470 T432I probably benign Het
Rad21 G C 15: 51,973,243 F177L probably benign Het
Rnf182 G A 13: 43,668,677 V235I probably benign Het
Scn11a C T 9: 119,769,948 C1172Y probably damaging Het
Sh2b3 A G 5: 121,828,679 L124P possibly damaging Het
Six2 T C 17: 85,685,478 N199S probably benign Het
Slc5a3 A G 16: 92,077,814 D253G probably benign Het
Synm A G 7: 67,735,277 M879T probably benign Het
Tasp1 A G 2: 139,910,535 I328T possibly damaging Het
Tbrg4 T C 11: 6,619,689 Q309R probably damaging Het
Tcrg-C3 A T 13: 19,263,362 R162* probably null Het
Tmtc2 A G 10: 105,303,604 L687P probably damaging Het
Tufm T C 7: 126,487,449 M1T probably null Het
Vmn2r116 A C 17: 23,388,947 L496F probably benign Het
Vmn2r75 C T 7: 86,165,583 C234Y probably damaging Het
Wars2 G T 3: 99,205,279 V162L possibly damaging Het
Zc3h11a A T 1: 133,624,611 V586D probably benign Het
Zdhhc5 A T 2: 84,690,227 N535K probably damaging Het
Zfp52 T C 17: 21,557,216 Y38H probably damaging Het
Zfp729b T C 13: 67,591,423 M908V probably benign Het
Other mutations in Zfp772
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Zfp772 APN 7 7204116 missense probably benign
IGL01589:Zfp772 APN 7 7205524 missense possibly damaging 0.53
R1945:Zfp772 UTSW 7 7203630 missense probably benign 0.01
R3085:Zfp772 UTSW 7 7203700 missense possibly damaging 0.53
R5300:Zfp772 UTSW 7 7204158 missense probably benign
R5793:Zfp772 UTSW 7 7204284 missense probably benign 0.00
R6252:Zfp772 UTSW 7 7204019 missense possibly damaging 0.86
R6605:Zfp772 UTSW 7 7205548 missense possibly damaging 0.72
R6751:Zfp772 UTSW 7 7203717 missense possibly damaging 0.90
R6812:Zfp772 UTSW 7 7206308 missense possibly damaging 0.92
R8171:Zfp772 UTSW 7 7204097 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCACAGTCACTGCATATGC -3'
(R):5'- GCTGCTCCTAAGGTCCATAG -3'

Sequencing Primer
(F):5'- CTCCATGTTCATGGGGGCATC -3'
(R):5'- TGCTCCTAAGGTCCATAGAACATAAG -3'
Posted On2019-06-07