Incidental Mutation 'PIT4449001:Tufm'
ID555736
Institutional Source Beutler Lab
Gene Symbol Tufm
Ensembl Gene ENSMUSG00000073838
Gene NameTu translation elongation factor, mitochondrial
SynonymsEF-TuMT, C76308, 2300002G02Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #PIT4449001 (G1)
Quality Score202.009
Status Not validated
Chromosome7
Chromosomal Location126487361-126490731 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to C at 126487449 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000095656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040202] [ENSMUST00000098048] [ENSMUST00000106392] [ENSMUST00000167759] [ENSMUST00000206055] [ENSMUST00000206265] [ENSMUST00000206572] [ENSMUST00000206577]
Predicted Effect probably benign
Transcript: ENSMUST00000040202
SMART Domains Protein: ENSMUSP00000035415
Gene: ENSMUSG00000032637

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
low complexity region 36 54 N/A INTRINSIC
low complexity region 56 73 N/A INTRINSIC
Pfam:SM-ATX 119 189 8.5e-21 PFAM
LsmAD 262 331 1.95e-28 SMART
low complexity region 357 382 N/A INTRINSIC
low complexity region 450 470 N/A INTRINSIC
Pfam:PAM2 657 672 5.6e-8 PFAM
low complexity region 681 697 N/A INTRINSIC
low complexity region 764 787 N/A INTRINSIC
low complexity region 920 947 N/A INTRINSIC
low complexity region 979 991 N/A INTRINSIC
low complexity region 997 1008 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000098048
AA Change: M1T

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000095656
Gene: ENSMUSG00000073838
AA Change: M1T

DomainStartEndE-ValueType
Pfam:GTP_EFTU 55 249 2e-55 PFAM
Pfam:GTP_EFTU_D2 272 341 1.3e-15 PFAM
Pfam:GTP_EFTU_D3 345 440 1.1e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106392
AA Change: M1T

PolyPhen 2 Score 0.382 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102000
Gene: ENSMUSG00000073838
AA Change: M1T

DomainStartEndE-ValueType
Pfam:GTP_EFTU 55 249 2.7e-57 PFAM
Pfam:GTP_EFTU_D2 272 341 2.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167759
SMART Domains Protein: ENSMUSP00000132959
Gene: ENSMUSG00000032637

DomainStartEndE-ValueType
Pfam:SM-ATX 33 103 8.1e-23 PFAM
LsmAD 176 245 1.95e-28 SMART
low complexity region 271 296 N/A INTRINSIC
low complexity region 364 384 N/A INTRINSIC
Pfam:PAM2 571 587 4.2e-8 PFAM
low complexity region 595 611 N/A INTRINSIC
low complexity region 678 701 N/A INTRINSIC
low complexity region 834 861 N/A INTRINSIC
low complexity region 893 905 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
low complexity region 944 960 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206055
Predicted Effect probably benign
Transcript: ENSMUST00000206265
Predicted Effect probably benign
Transcript: ENSMUST00000206572
Predicted Effect probably benign
Transcript: ENSMUST00000206577
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which participates in protein translation in mitochondria. Mutations in this gene have been associated with combined oxidative phosphorylation deficiency resulting in lactic acidosis and fatal encephalopathy. A pseudogene has been identified on chromosome 17. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asf1b A G 8: 83,967,982 N125S probably benign Het
BC048671 T A 6: 90,305,163 L101I probably damaging Het
Camta1 A G 4: 151,131,586 L959P probably benign Het
Cfh C A 1: 140,112,565 V598F probably damaging Het
Cyp2j7 G T 4: 96,215,338 T320K probably damaging Het
Ddr1 A G 17: 35,687,249 I468T possibly damaging Het
Dhx15 A G 5: 52,160,958 V510A probably damaging Het
Dpp4 T A 2: 62,356,644 K507N probably benign Het
Evpl G A 11: 116,233,399 T198M possibly damaging Het
Gabbr1 G A 17: 37,056,350 V373I probably damaging Het
Gak A T 5: 108,580,925 S1049T probably benign Het
Gipr C T 7: 19,160,618 R253H probably benign Het
Gm3685 T A 14: 7,043,960 M73L probably benign Het
Gm5168 C T X: 26,039,540 R129Q probably null Het
Kcnh1 T A 1: 192,418,684 V555D probably damaging Het
Kif26b T C 1: 178,918,086 S1916P probably damaging Het
Lingo4 T C 3: 94,401,932 V59A probably benign Het
Maats1 T C 16: 38,328,358 E236G probably damaging Het
Mroh8 T A 2: 157,225,534 Q635L probably damaging Het
Msh6 T A 17: 87,986,188 D790E probably damaging Het
Nrxn1 A T 17: 90,597,579 W809R probably damaging Het
Olfr201 C A 16: 59,269,130 C179F probably damaging Het
Polr3d T C 14: 70,439,463 H397R probably benign Het
Pwp2 G A 10: 78,178,470 T432I probably benign Het
Rad21 G C 15: 51,973,243 F177L probably benign Het
Rnf182 G A 13: 43,668,677 V235I probably benign Het
Scn11a C T 9: 119,769,948 C1172Y probably damaging Het
Sh2b3 A G 5: 121,828,679 L124P possibly damaging Het
Six2 T C 17: 85,685,478 N199S probably benign Het
Slc5a3 A G 16: 92,077,814 D253G probably benign Het
Synm A G 7: 67,735,277 M879T probably benign Het
Tasp1 A G 2: 139,910,535 I328T possibly damaging Het
Tbrg4 T C 11: 6,619,689 Q309R probably damaging Het
Tcrg-C3 A T 13: 19,263,362 R162* probably null Het
Tmtc2 A G 10: 105,303,604 L687P probably damaging Het
Vmn2r116 A C 17: 23,388,947 L496F probably benign Het
Vmn2r75 C T 7: 86,165,583 C234Y probably damaging Het
Wars2 G T 3: 99,205,279 V162L possibly damaging Het
Zc3h11a A T 1: 133,624,611 V586D probably benign Het
Zdhhc5 A T 2: 84,690,227 N535K probably damaging Het
Zfp52 T C 17: 21,557,216 Y38H probably damaging Het
Zfp729b T C 13: 67,591,423 M908V probably benign Het
Zfp772 T C 7: 7,204,351 I114V probably benign Het
Other mutations in Tufm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02148:Tufm APN 7 126489160 missense probably damaging 1.00
R0140:Tufm UTSW 7 126489831 missense probably damaging 1.00
R0383:Tufm UTSW 7 126489864 missense probably damaging 1.00
R0615:Tufm UTSW 7 126487482 missense probably benign
R1158:Tufm UTSW 7 126489442 critical splice donor site probably null
R1713:Tufm UTSW 7 126487699 missense probably benign 0.00
R1766:Tufm UTSW 7 126490472 missense probably benign 0.10
R2172:Tufm UTSW 7 126488847 missense probably benign 0.01
R3721:Tufm UTSW 7 126490460 missense probably benign
R6027:Tufm UTSW 7 126487748 missense probably damaging 1.00
R6331:Tufm UTSW 7 126489238 missense probably benign 0.07
R6983:Tufm UTSW 7 126489435 missense possibly damaging 0.85
R7324:Tufm UTSW 7 126489587 missense possibly damaging 0.82
R7430:Tufm UTSW 7 126489127 missense probably benign 0.06
R7883:Tufm UTSW 7 126488942 missense possibly damaging 0.85
X0067:Tufm UTSW 7 126488332 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAAATTCCCCATCGTCCC -3'
(R):5'- GACCTTGCAGAAATGGGGTC -3'

Sequencing Primer
(F):5'- GCTCCATGCCCGGATATCAG -3'
(R):5'- AAATGGGGTCGGGCTGGC -3'
Posted On2019-06-07