Incidental Mutation 'PIT4449001:Maats1'
ID555749
Institutional Source Beutler Lab
Gene Symbol Maats1
Ensembl Gene ENSMUSG00000022805
Gene NameMYCBP-associated, testis expressed 1
SynonymsSpata26, 4932425I24Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4449001 (G1)
Quality Score136.008
Status Not validated
Chromosome16
Chromosomal Location38297754-38342143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38328358 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 236 (E236G)
Ref Sequence ENSEMBL: ENSMUSP00000023501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023501] [ENSMUST00000114740]
Predicted Effect probably damaging
Transcript: ENSMUST00000023501
AA Change: E236G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023501
Gene: ENSMUSG00000022805
AA Change: E236G

DomainStartEndE-ValueType
Pfam:PaaSYMP 190 342 1.4e-65 PFAM
low complexity region 413 428 N/A INTRINSIC
low complexity region 513 526 N/A INTRINSIC
low complexity region 599 613 N/A INTRINSIC
coiled coil region 650 682 N/A INTRINSIC
coiled coil region 737 763 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114740
AA Change: E236G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110388
Gene: ENSMUSG00000022805
AA Change: E236G

DomainStartEndE-ValueType
Pfam:PaaSYMP 189 342 1.3e-61 PFAM
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asf1b A G 8: 83,967,982 N125S probably benign Het
BC048671 T A 6: 90,305,163 L101I probably damaging Het
Camta1 A G 4: 151,131,586 L959P probably benign Het
Cfh C A 1: 140,112,565 V598F probably damaging Het
Cyp2j7 G T 4: 96,215,338 T320K probably damaging Het
Ddr1 A G 17: 35,687,249 I468T possibly damaging Het
Dhx15 A G 5: 52,160,958 V510A probably damaging Het
Dpp4 T A 2: 62,356,644 K507N probably benign Het
Evpl G A 11: 116,233,399 T198M possibly damaging Het
Gabbr1 G A 17: 37,056,350 V373I probably damaging Het
Gak A T 5: 108,580,925 S1049T probably benign Het
Gipr C T 7: 19,160,618 R253H probably benign Het
Gm3685 T A 14: 7,043,960 M73L probably benign Het
Gm5168 C T X: 26,039,540 R129Q probably null Het
Kcnh1 T A 1: 192,418,684 V555D probably damaging Het
Kif26b T C 1: 178,918,086 S1916P probably damaging Het
Lingo4 T C 3: 94,401,932 V59A probably benign Het
Mroh8 T A 2: 157,225,534 Q635L probably damaging Het
Msh6 T A 17: 87,986,188 D790E probably damaging Het
Nrxn1 A T 17: 90,597,579 W809R probably damaging Het
Olfr201 C A 16: 59,269,130 C179F probably damaging Het
Polr3d T C 14: 70,439,463 H397R probably benign Het
Pwp2 G A 10: 78,178,470 T432I probably benign Het
Rad21 G C 15: 51,973,243 F177L probably benign Het
Rnf182 G A 13: 43,668,677 V235I probably benign Het
Scn11a C T 9: 119,769,948 C1172Y probably damaging Het
Sh2b3 A G 5: 121,828,679 L124P possibly damaging Het
Six2 T C 17: 85,685,478 N199S probably benign Het
Slc5a3 A G 16: 92,077,814 D253G probably benign Het
Synm A G 7: 67,735,277 M879T probably benign Het
Tasp1 A G 2: 139,910,535 I328T possibly damaging Het
Tbrg4 T C 11: 6,619,689 Q309R probably damaging Het
Tcrg-C3 A T 13: 19,263,362 R162* probably null Het
Tmtc2 A G 10: 105,303,604 L687P probably damaging Het
Tufm T C 7: 126,487,449 M1T probably null Het
Vmn2r116 A C 17: 23,388,947 L496F probably benign Het
Vmn2r75 C T 7: 86,165,583 C234Y probably damaging Het
Wars2 G T 3: 99,205,279 V162L possibly damaging Het
Zc3h11a A T 1: 133,624,611 V586D probably benign Het
Zdhhc5 A T 2: 84,690,227 N535K probably damaging Het
Zfp52 T C 17: 21,557,216 Y38H probably damaging Het
Zfp729b T C 13: 67,591,423 M908V probably benign Het
Zfp772 T C 7: 7,204,351 I114V probably benign Het
Other mutations in Maats1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Maats1 APN 16 38336342 critical splice donor site probably null
IGL02243:Maats1 APN 16 38341780 utr 5 prime probably benign
IGL02377:Maats1 APN 16 38332819 splice site probably benign
IGL02604:Maats1 APN 16 38321559 unclassified probably benign
IGL02623:Maats1 APN 16 38333778 missense possibly damaging 0.51
IGL02985:Maats1 APN 16 38298272 missense probably damaging 0.98
IGL03389:Maats1 APN 16 38324136 critical splice donor site probably null
PIT4280001:Maats1 UTSW 16 38332773 missense probably benign 0.23
R0076:Maats1 UTSW 16 38302684 nonsense probably null
R0076:Maats1 UTSW 16 38302684 nonsense probably null
R0360:Maats1 UTSW 16 38298297 critical splice acceptor site probably null
R0501:Maats1 UTSW 16 38335635 missense probably damaging 1.00
R0523:Maats1 UTSW 16 38328374 missense probably damaging 1.00
R0743:Maats1 UTSW 16 38335634 missense possibly damaging 0.48
R0900:Maats1 UTSW 16 38336402 missense possibly damaging 0.70
R1218:Maats1 UTSW 16 38298133 missense probably benign
R1499:Maats1 UTSW 16 38321400 missense probably damaging 0.96
R1693:Maats1 UTSW 16 38341723 missense probably benign
R1793:Maats1 UTSW 16 38321419 missense possibly damaging 0.77
R1854:Maats1 UTSW 16 38324297 splice site probably null
R2007:Maats1 UTSW 16 38298254 missense probably benign 0.02
R2126:Maats1 UTSW 16 38341762 missense probably benign 0.19
R2443:Maats1 UTSW 16 38302732 missense probably damaging 1.00
R2857:Maats1 UTSW 16 38302713 missense probably damaging 1.00
R2937:Maats1 UTSW 16 38311038 missense possibly damaging 0.65
R3441:Maats1 UTSW 16 38333806 missense probably benign 0.03
R3442:Maats1 UTSW 16 38333806 missense probably benign 0.03
R4056:Maats1 UTSW 16 38298214 missense probably benign
R4057:Maats1 UTSW 16 38298214 missense probably benign
R4424:Maats1 UTSW 16 38320365 missense probably damaging 1.00
R4493:Maats1 UTSW 16 38341768 missense probably benign 0.00
R4546:Maats1 UTSW 16 38335523 missense probably benign 0.11
R5177:Maats1 UTSW 16 38332321 missense probably benign 0.00
R5496:Maats1 UTSW 16 38321493 missense probably damaging 1.00
R5868:Maats1 UTSW 16 38332242 missense probably damaging 1.00
R5944:Maats1 UTSW 16 38328310 missense probably damaging 0.97
R6165:Maats1 UTSW 16 38333811 missense possibly damaging 0.93
R6521:Maats1 UTSW 16 38306759 missense probably benign 0.06
R6804:Maats1 UTSW 16 38332242 missense probably damaging 0.97
R7086:Maats1 UTSW 16 38306857 missense possibly damaging 0.70
R7202:Maats1 UTSW 16 38335597 missense probably benign 0.00
R7271:Maats1 UTSW 16 38328346 missense probably damaging 1.00
R7325:Maats1 UTSW 16 38321601 splice site probably null
R7375:Maats1 UTSW 16 38335618 missense probably damaging 0.97
R7453:Maats1 UTSW 16 38321479 missense possibly damaging 0.51
R7604:Maats1 UTSW 16 38298236 nonsense probably null
R8040:Maats1 UTSW 16 38320371 missense possibly damaging 0.89
X0062:Maats1 UTSW 16 38298099 missense possibly damaging 0.70
X0067:Maats1 UTSW 16 38306860 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AATAACGTGTGTACACCCATGAG -3'
(R):5'- AAAACAATGTCTGCCTCAGTAAGAG -3'

Sequencing Primer
(F):5'- TGTGTACACCCATGAGCCCAG -3'
(R):5'- CACGAAGGCCACATGCTAGTTTTG -3'
Posted On2019-06-07