Incidental Mutation 'PIT4449001:Zfp52'
ID555752
Institutional Source Beutler Lab
Gene Symbol Zfp52
Ensembl Gene ENSMUSG00000051341
Gene Namezinc finger protein 52
SynonymsKRAB11, Zfp-52, zfec29, Zfp76
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #PIT4449001 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location21555046-21562066 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21557216 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 38 (Y38H)
Ref Sequence ENSEMBL: ENSMUSP00000078233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079242]
Predicted Effect probably damaging
Transcript: ENSMUST00000079242
AA Change: Y38H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078233
Gene: ENSMUSG00000051341
AA Change: Y38H

DomainStartEndE-ValueType
KRAB 13 73 3.79e-24 SMART
ZnF_C2H2 186 208 1.79e-2 SMART
ZnF_C2H2 214 236 5.07e0 SMART
ZnF_C2H2 242 264 2.29e1 SMART
ZnF_C2H2 270 292 2.36e-2 SMART
ZnF_C2H2 298 320 4.72e-2 SMART
ZnF_C2H2 326 348 1.77e1 SMART
ZnF_C2H2 382 404 1.12e-3 SMART
ZnF_C2H2 410 432 1.34e2 SMART
ZnF_C2H2 438 460 1.06e-4 SMART
ZnF_C2H2 466 488 6.99e-5 SMART
ZnF_C2H2 494 516 4.17e-3 SMART
ZnF_C2H2 522 544 5.5e-3 SMART
ZnF_C2H2 550 572 8.47e-4 SMART
ZnF_C2H2 578 600 1.01e-1 SMART
ZnF_C2H2 606 628 9.73e-4 SMART
ZnF_C2H2 634 656 4.17e-3 SMART
ZnF_C2H2 662 684 6.32e-3 SMART
ZnF_C2H2 690 712 1.69e-3 SMART
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asf1b A G 8: 83,967,982 N125S probably benign Het
BC048671 T A 6: 90,305,163 L101I probably damaging Het
Camta1 A G 4: 151,131,586 L959P probably benign Het
Cfh C A 1: 140,112,565 V598F probably damaging Het
Cyp2j7 G T 4: 96,215,338 T320K probably damaging Het
Ddr1 A G 17: 35,687,249 I468T possibly damaging Het
Dhx15 A G 5: 52,160,958 V510A probably damaging Het
Dpp4 T A 2: 62,356,644 K507N probably benign Het
Evpl G A 11: 116,233,399 T198M possibly damaging Het
Gabbr1 G A 17: 37,056,350 V373I probably damaging Het
Gak A T 5: 108,580,925 S1049T probably benign Het
Gipr C T 7: 19,160,618 R253H probably benign Het
Gm3685 T A 14: 7,043,960 M73L probably benign Het
Gm5168 C T X: 26,039,540 R129Q probably null Het
Kcnh1 T A 1: 192,418,684 V555D probably damaging Het
Kif26b T C 1: 178,918,086 S1916P probably damaging Het
Lingo4 T C 3: 94,401,932 V59A probably benign Het
Maats1 T C 16: 38,328,358 E236G probably damaging Het
Mroh8 T A 2: 157,225,534 Q635L probably damaging Het
Msh6 T A 17: 87,986,188 D790E probably damaging Het
Nrxn1 A T 17: 90,597,579 W809R probably damaging Het
Olfr201 C A 16: 59,269,130 C179F probably damaging Het
Polr3d T C 14: 70,439,463 H397R probably benign Het
Pwp2 G A 10: 78,178,470 T432I probably benign Het
Rad21 G C 15: 51,973,243 F177L probably benign Het
Rnf182 G A 13: 43,668,677 V235I probably benign Het
Scn11a C T 9: 119,769,948 C1172Y probably damaging Het
Sh2b3 A G 5: 121,828,679 L124P possibly damaging Het
Six2 T C 17: 85,685,478 N199S probably benign Het
Slc5a3 A G 16: 92,077,814 D253G probably benign Het
Synm A G 7: 67,735,277 M879T probably benign Het
Tasp1 A G 2: 139,910,535 I328T possibly damaging Het
Tbrg4 T C 11: 6,619,689 Q309R probably damaging Het
Tcrg-C3 A T 13: 19,263,362 R162* probably null Het
Tmtc2 A G 10: 105,303,604 L687P probably damaging Het
Tufm T C 7: 126,487,449 M1T probably null Het
Vmn2r116 A C 17: 23,388,947 L496F probably benign Het
Vmn2r75 C T 7: 86,165,583 C234Y probably damaging Het
Wars2 G T 3: 99,205,279 V162L possibly damaging Het
Zc3h11a A T 1: 133,624,611 V586D probably benign Het
Zdhhc5 A T 2: 84,690,227 N535K probably damaging Het
Zfp729b T C 13: 67,591,423 M908V probably benign Het
Zfp772 T C 7: 7,204,351 I114V probably benign Het
Other mutations in Zfp52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01752:Zfp52 APN 17 21560150 missense probably benign 0.12
R0270:Zfp52 UTSW 17 21561302 missense probably damaging 1.00
R0674:Zfp52 UTSW 17 21561846 missense probably damaging 1.00
R1224:Zfp52 UTSW 17 21555062 missense possibly damaging 0.70
R1248:Zfp52 UTSW 17 21560049 missense probably damaging 1.00
R1622:Zfp52 UTSW 17 21561571 missense probably benign 0.00
R1663:Zfp52 UTSW 17 21561822 missense possibly damaging 0.59
R1917:Zfp52 UTSW 17 21560164 missense probably benign
R4272:Zfp52 UTSW 17 21560197 nonsense probably null
R4273:Zfp52 UTSW 17 21560197 nonsense probably null
R4278:Zfp52 UTSW 17 21561870 missense probably benign
R4683:Zfp52 UTSW 17 21561507 missense probably benign 0.31
R4865:Zfp52 UTSW 17 21561243 missense probably damaging 1.00
R4964:Zfp52 UTSW 17 21560403 missense probably benign 0.04
R4966:Zfp52 UTSW 17 21560403 missense probably benign 0.04
R5430:Zfp52 UTSW 17 21555067 missense probably benign 0.01
R5685:Zfp52 UTSW 17 21561751 missense probably benign 0.15
R6133:Zfp52 UTSW 17 21560471 missense probably damaging 1.00
R6882:Zfp52 UTSW 17 21555047 start codon destroyed probably null 1.00
R7083:Zfp52 UTSW 17 21560130 missense possibly damaging 0.86
R7439:Zfp52 UTSW 17 21560870 nonsense probably null
R7456:Zfp52 UTSW 17 21561353 missense probably damaging 1.00
R7740:Zfp52 UTSW 17 21560990 missense probably damaging 1.00
R8196:Zfp52 UTSW 17 21561894 missense possibly damaging 0.45
Predicted Primers PCR Primer
(F):5'- GCTTGTGAGACTATTGTGTCATCC -3'
(R):5'- GCAGCTGAACCTCTTGGAAAATTTC -3'

Sequencing Primer
(F):5'- TGGCTATCCTGGAACCCAC -3'
(R):5'- TTTACAGCCTATAGGGCC -3'
Posted On2019-06-07