Incidental Mutation 'PIT4449001:Vmn2r116'
ID555753
Institutional Source Beutler Lab
Gene Symbol Vmn2r116
Ensembl Gene ENSMUSG00000090966
Gene Namevomeronasal 2, receptor 116
SynonymsV2Rp5, EG619697
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #PIT4449001 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location23384803-23401864 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 23388947 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 496 (L496F)
Ref Sequence ENSEMBL: ENSMUSP00000128106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164856]
Predicted Effect probably benign
Transcript: ENSMUST00000164856
AA Change: L496F

PolyPhen 2 Score 0.409 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000128106
Gene: ENSMUSG00000090966
AA Change: L496F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 4.4e-30 PFAM
Pfam:NCD3G 511 564 1.2e-22 PFAM
low complexity region 589 594 N/A INTRINSIC
Pfam:7tm_3 595 832 8.7e-57 PFAM
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Female mice homozygous for a knock-out allele stimulated with male pheromone (Gm6084) fail to exhibit an increase in lordosis behavior and successful intromission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asf1b A G 8: 83,967,982 N125S probably benign Het
BC048671 T A 6: 90,305,163 L101I probably damaging Het
Camta1 A G 4: 151,131,586 L959P probably benign Het
Cfh C A 1: 140,112,565 V598F probably damaging Het
Cyp2j7 G T 4: 96,215,338 T320K probably damaging Het
Ddr1 A G 17: 35,687,249 I468T possibly damaging Het
Dhx15 A G 5: 52,160,958 V510A probably damaging Het
Dpp4 T A 2: 62,356,644 K507N probably benign Het
Evpl G A 11: 116,233,399 T198M possibly damaging Het
Gabbr1 G A 17: 37,056,350 V373I probably damaging Het
Gak A T 5: 108,580,925 S1049T probably benign Het
Gipr C T 7: 19,160,618 R253H probably benign Het
Gm3685 T A 14: 7,043,960 M73L probably benign Het
Gm5168 C T X: 26,039,540 R129Q probably null Het
Kcnh1 T A 1: 192,418,684 V555D probably damaging Het
Kif26b T C 1: 178,918,086 S1916P probably damaging Het
Lingo4 T C 3: 94,401,932 V59A probably benign Het
Maats1 T C 16: 38,328,358 E236G probably damaging Het
Mroh8 T A 2: 157,225,534 Q635L probably damaging Het
Msh6 T A 17: 87,986,188 D790E probably damaging Het
Nrxn1 A T 17: 90,597,579 W809R probably damaging Het
Olfr201 C A 16: 59,269,130 C179F probably damaging Het
Polr3d T C 14: 70,439,463 H397R probably benign Het
Pwp2 G A 10: 78,178,470 T432I probably benign Het
Rad21 G C 15: 51,973,243 F177L probably benign Het
Rnf182 G A 13: 43,668,677 V235I probably benign Het
Scn11a C T 9: 119,769,948 C1172Y probably damaging Het
Sh2b3 A G 5: 121,828,679 L124P possibly damaging Het
Six2 T C 17: 85,685,478 N199S probably benign Het
Slc5a3 A G 16: 92,077,814 D253G probably benign Het
Synm A G 7: 67,735,277 M879T probably benign Het
Tasp1 A G 2: 139,910,535 I328T possibly damaging Het
Tbrg4 T C 11: 6,619,689 Q309R probably damaging Het
Tcrg-C3 A T 13: 19,263,362 R162* probably null Het
Tmtc2 A G 10: 105,303,604 L687P probably damaging Het
Tufm T C 7: 126,487,449 M1T probably null Het
Vmn2r75 C T 7: 86,165,583 C234Y probably damaging Het
Wars2 G T 3: 99,205,279 V162L possibly damaging Het
Zc3h11a A T 1: 133,624,611 V586D probably benign Het
Zdhhc5 A T 2: 84,690,227 N535K probably damaging Het
Zfp52 T C 17: 21,557,216 Y38H probably damaging Het
Zfp729b T C 13: 67,591,423 M908V probably benign Het
Zfp772 T C 7: 7,204,351 I114V probably benign Het
Other mutations in Vmn2r116
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Vmn2r116 APN 17 23385995 missense possibly damaging 0.94
IGL00985:Vmn2r116 APN 17 23401515 missense probably damaging 1.00
IGL00990:Vmn2r116 APN 17 23397727 missense probably damaging 1.00
IGL00990:Vmn2r116 APN 17 23387236 missense probably benign 0.12
IGL01383:Vmn2r116 APN 17 23401601 missense probably damaging 1.00
IGL01459:Vmn2r116 APN 17 23384929 missense probably damaging 1.00
IGL01725:Vmn2r116 APN 17 23386645 missense probably damaging 1.00
IGL02125:Vmn2r116 APN 17 23397627 splice site probably benign
IGL02170:Vmn2r116 APN 17 23384933 missense probably benign
IGL02209:Vmn2r116 APN 17 23388787 missense probably damaging 1.00
IGL02226:Vmn2r116 APN 17 23384834 missense probably null
IGL02272:Vmn2r116 APN 17 23385999 missense probably benign 0.06
IGL02272:Vmn2r116 APN 17 23386004 missense probably damaging 1.00
IGL02403:Vmn2r116 APN 17 23387364 missense probably damaging 1.00
IGL02686:Vmn2r116 APN 17 23388793 missense probably damaging 0.99
IGL02750:Vmn2r116 APN 17 23397634 splice site probably benign
IGL02977:Vmn2r116 APN 17 23388774 missense possibly damaging 0.90
R0015:Vmn2r116 UTSW 17 23401849 missense probably benign 0.03
R0219:Vmn2r116 UTSW 17 23386098 nonsense probably null
R0281:Vmn2r116 UTSW 17 23401413 missense possibly damaging 0.90
R0415:Vmn2r116 UTSW 17 23387279 missense possibly damaging 0.55
R0592:Vmn2r116 UTSW 17 23386915 missense probably damaging 0.99
R0610:Vmn2r116 UTSW 17 23387312 missense probably damaging 1.00
R0635:Vmn2r116 UTSW 17 23386887 missense possibly damaging 0.95
R0843:Vmn2r116 UTSW 17 23400960 missense probably benign 0.01
R1329:Vmn2r116 UTSW 17 23387188 missense possibly damaging 0.89
R1396:Vmn2r116 UTSW 17 23386141 missense probably benign
R1401:Vmn2r116 UTSW 17 23386596 splice site probably benign
R1574:Vmn2r116 UTSW 17 23387089 missense probably damaging 0.99
R1574:Vmn2r116 UTSW 17 23387089 missense probably damaging 0.99
R1766:Vmn2r116 UTSW 17 23401766 missense probably damaging 0.98
R2157:Vmn2r116 UTSW 17 23401469 missense probably damaging 1.00
R3622:Vmn2r116 UTSW 17 23386051 missense probably benign 0.11
R3690:Vmn2r116 UTSW 17 23384824 missense unknown
R4298:Vmn2r116 UTSW 17 23401827 missense possibly damaging 0.69
R4373:Vmn2r116 UTSW 17 23401421 missense probably benign 0.01
R4860:Vmn2r116 UTSW 17 23401803 missense probably benign
R4941:Vmn2r116 UTSW 17 23401142 missense probably damaging 1.00
R5119:Vmn2r116 UTSW 17 23387164 missense probably benign 0.01
R5503:Vmn2r116 UTSW 17 23386804 missense probably benign 0.07
R5510:Vmn2r116 UTSW 17 23386121 missense probably damaging 1.00
R5538:Vmn2r116 UTSW 17 23401067 missense probably benign 0.00
R5689:Vmn2r116 UTSW 17 23397719 missense probably benign 0.30
R5765:Vmn2r116 UTSW 17 23401404 missense probably damaging 0.99
R5794:Vmn2r116 UTSW 17 23385968 missense probably damaging 0.99
R5807:Vmn2r116 UTSW 17 23387307 missense probably damaging 1.00
R5837:Vmn2r116 UTSW 17 23387080 missense probably damaging 1.00
R6262:Vmn2r116 UTSW 17 23387377 missense probably benign 0.03
R6298:Vmn2r116 UTSW 17 23386762 missense probably damaging 1.00
R6651:Vmn2r116 UTSW 17 23388831 nonsense probably null
R6667:Vmn2r116 UTSW 17 23401092 missense probably damaging 1.00
R7393:Vmn2r116 UTSW 17 23386125 missense probably benign 0.14
R7571:Vmn2r116 UTSW 17 23384856 splice site probably null
R7940:Vmn2r116 UTSW 17 23386972 missense probably damaging 0.99
R8510:Vmn2r116 UTSW 17 23385931 nonsense probably null
S24628:Vmn2r116 UTSW 17 23387279 missense possibly damaging 0.55
Z1176:Vmn2r116 UTSW 17 23401428 missense probably damaging 1.00
Z1177:Vmn2r116 UTSW 17 23388892 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCAGCATATTGCCAATAAAGTTG -3'
(R):5'- TTCACGTTGGAAATCCTCAATG -3'

Sequencing Primer
(F):5'- GCCAATAAAGTTGCCTTTAAGATGAG -3'
(R):5'- CACGTTGGAAATCCTCAATGAATTAC -3'
Posted On2019-06-07