Incidental Mutation 'PIT4449001:Six2'
ID555756
Institutional Source Beutler Lab
Gene Symbol Six2
Ensembl Gene ENSMUSG00000024134
Gene Namesine oculis-related homeobox 2
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4449001 (G1)
Quality Score204.009
Status Not validated
Chromosome17
Chromosomal Location85684277-85688274 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85685478 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 199 (N199S)
Ref Sequence ENSEMBL: ENSMUSP00000024947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024947] [ENSMUST00000163568]
Predicted Effect probably benign
Transcript: ENSMUST00000024947
AA Change: N199S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000024947
Gene: ENSMUSG00000024134
AA Change: N199S

DomainStartEndE-ValueType
HOX 125 186 8.72e-18 SMART
low complexity region 228 269 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163568
AA Change: N199S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000125871
Gene: ENSMUSG00000024134
AA Change: N199S

DomainStartEndE-ValueType
Pfam:SIX1_SD 9 119 1.5e-52 PFAM
HOX 125 186 8.72e-18 SMART
low complexity region 228 269 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the vertebrate gene family which encode proteins homologous to the Drosophila 'sine oculis' homeobox protein. The encoded protein is a transcription factor which, like other members of this gene family, may be involved in limb or eye development. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die shortly after birth and exhibit abnormal kidney development. Abnormalities include small kidney, lack of ureteric bud branches throughout the kidney, increased apoptosis and premature and arrested nephron development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asf1b A G 8: 83,967,982 N125S probably benign Het
BC048671 T A 6: 90,305,163 L101I probably damaging Het
Camta1 A G 4: 151,131,586 L959P probably benign Het
Cfh C A 1: 140,112,565 V598F probably damaging Het
Cyp2j7 G T 4: 96,215,338 T320K probably damaging Het
Ddr1 A G 17: 35,687,249 I468T possibly damaging Het
Dhx15 A G 5: 52,160,958 V510A probably damaging Het
Dpp4 T A 2: 62,356,644 K507N probably benign Het
Evpl G A 11: 116,233,399 T198M possibly damaging Het
Gabbr1 G A 17: 37,056,350 V373I probably damaging Het
Gak A T 5: 108,580,925 S1049T probably benign Het
Gipr C T 7: 19,160,618 R253H probably benign Het
Gm3685 T A 14: 7,043,960 M73L probably benign Het
Gm5168 C T X: 26,039,540 R129Q probably null Het
Kcnh1 T A 1: 192,418,684 V555D probably damaging Het
Kif26b T C 1: 178,918,086 S1916P probably damaging Het
Lingo4 T C 3: 94,401,932 V59A probably benign Het
Maats1 T C 16: 38,328,358 E236G probably damaging Het
Mroh8 T A 2: 157,225,534 Q635L probably damaging Het
Msh6 T A 17: 87,986,188 D790E probably damaging Het
Nrxn1 A T 17: 90,597,579 W809R probably damaging Het
Olfr201 C A 16: 59,269,130 C179F probably damaging Het
Polr3d T C 14: 70,439,463 H397R probably benign Het
Pwp2 G A 10: 78,178,470 T432I probably benign Het
Rad21 G C 15: 51,973,243 F177L probably benign Het
Rnf182 G A 13: 43,668,677 V235I probably benign Het
Scn11a C T 9: 119,769,948 C1172Y probably damaging Het
Sh2b3 A G 5: 121,828,679 L124P possibly damaging Het
Slc5a3 A G 16: 92,077,814 D253G probably benign Het
Synm A G 7: 67,735,277 M879T probably benign Het
Tasp1 A G 2: 139,910,535 I328T possibly damaging Het
Tbrg4 T C 11: 6,619,689 Q309R probably damaging Het
Tcrg-C3 A T 13: 19,263,362 R162* probably null Het
Tmtc2 A G 10: 105,303,604 L687P probably damaging Het
Tufm T C 7: 126,487,449 M1T probably null Het
Vmn2r116 A C 17: 23,388,947 L496F probably benign Het
Vmn2r75 C T 7: 86,165,583 C234Y probably damaging Het
Wars2 G T 3: 99,205,279 V162L possibly damaging Het
Zc3h11a A T 1: 133,624,611 V586D probably benign Het
Zdhhc5 A T 2: 84,690,227 N535K probably damaging Het
Zfp52 T C 17: 21,557,216 Y38H probably damaging Het
Zfp729b T C 13: 67,591,423 M908V probably benign Het
Zfp772 T C 7: 7,204,351 I114V probably benign Het
Other mutations in Six2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Six2 APN 17 85687891 missense probably damaging 1.00
IGL02452:Six2 APN 17 85685378 missense possibly damaging 0.91
IGL02468:Six2 APN 17 85685503 missense possibly damaging 0.80
PIT4812001:Six2 UTSW 17 85685301 missense possibly damaging 0.92
R2073:Six2 UTSW 17 85687505 missense probably damaging 1.00
R2075:Six2 UTSW 17 85687505 missense probably damaging 1.00
R2915:Six2 UTSW 17 85685188 missense probably damaging 1.00
R3830:Six2 UTSW 17 85685187 missense probably damaging 1.00
R5834:Six2 UTSW 17 85687664 missense probably damaging 0.96
R7555:Six2 UTSW 17 85687707 missense probably damaging 1.00
R7723:Six2 UTSW 17 85687675 missense probably benign 0.06
R8011:Six2 UTSW 17 85687672 missense probably damaging 1.00
Z1176:Six2 UTSW 17 85685456 missense probably benign 0.26
Z1177:Six2 UTSW 17 85687625 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAGTATGGAGTCCTGCAGG -3'
(R):5'- AACTAGTGTTGAGGGTTTGAGAAC -3'

Sequencing Primer
(F):5'- ACTGGTACGGGTACTGCG -3'
(R):5'- GGGTTTGAGAACGCAATTAAGAAC -3'
Posted On2019-06-07