Incidental Mutation 'PIT4466001:Olfr1271'
ID555762
Institutional Source Beutler Lab
Gene Symbol Olfr1271
Ensembl Gene ENSMUSG00000075062
Gene Nameolfactory receptor 1271
SynonymsGA_x6K02T2Q125-51620802-51619885, MOR227-5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #PIT4466001 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location90260546-90271032 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 90266295 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 45 (V45E)
Ref Sequence ENSEMBL: ENSMUSP00000149028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099751] [ENSMUST00000216383]
Predicted Effect probably damaging
Transcript: ENSMUST00000099751
AA Change: V45E

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097340
Gene: ENSMUSG00000075062
AA Change: V45E

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.1e-50 PFAM
Pfam:7tm_1 39 285 6.7e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216383
AA Change: V45E

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.9%
  • 10x: 85.1%
  • 20x: 72.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt C A 9: 99,620,560 P258T probably damaging Het
Adamts1 C A 16: 85,796,691 G719* probably null Het
Ano5 G T 7: 51,544,851 D111Y probably damaging Het
Arvcf T C 16: 18,402,949 V714A possibly damaging Het
AU021092 T A 16: 5,220,389 S85C probably damaging Het
C87414 A C 5: 93,636,288 L439R probably damaging Het
Capn5 T C 7: 98,123,988 D603G probably benign Het
Cbr1 T A 16: 93,609,804 V136E probably damaging Het
Ccdc27 T C 4: 154,041,727 M102V unknown Het
Ccr1 T C 9: 123,963,728 Y255C probably damaging Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 61,184,524 probably benign Het
Cep112 A G 11: 108,519,896 T553A probably benign Het
Chd7 C T 4: 8,753,101 L533F unknown Het
Cntnap1 T C 11: 101,177,305 F48L probably benign Het
Cyb5r3 T C 15: 83,161,863 D84G probably damaging Het
Ddx47 T C 6: 135,015,840 I154T probably benign Het
Dnah6 A G 6: 73,208,641 L99P probably benign Het
Dzank1 A G 2: 144,483,373 I558T probably benign Het
Fbn1 T C 2: 125,306,501 D2609G possibly damaging Het
Fhl5 C A 4: 25,211,194 C166F probably damaging Het
Fndc1 A G 17: 7,750,374 L1553P probably damaging Het
Frem1 G A 4: 82,972,137 T1035I probably benign Het
Gm3099 A G 14: 4,000,549 M128V probably benign Het
Gpaa1 C T 15: 76,334,740 T594I probably benign Het
Hck C T 2: 153,124,271 T55M probably damaging Het
Hectd4 T C 5: 121,333,060 probably null Het
Ica1l C T 1: 60,015,836 probably null Het
Ilf3 T C 9: 21,403,366 Y765H unknown Het
Mast4 G A 13: 102,804,718 T277M probably damaging Het
Mfsd6 T C 1: 52,708,897 T270A probably benign Het
Mib1 G A 18: 10,775,541 D498N probably benign Het
Naaladl1 A T 19: 6,114,633 T576S possibly damaging Het
Ncoa6 A T 2: 155,405,657 I1909N probably benign Het
Negr1 A G 3: 156,859,598 D107G probably benign Het
Nlrc4 A G 17: 74,427,119 M933T probably benign Het
Nmnat3 T G 9: 98,410,253 F184V probably benign Het
Olfr510 T C 7: 108,667,536 V40A possibly damaging Het
Olfr8 C A 10: 78,955,842 F212L probably benign Het
Olfr809 C T 10: 129,776,273 R120C probably benign Het
Pfkfb4 T C 9: 108,999,154 Y86H probably benign Het
Pgm5 T G 19: 24,824,329 Q178H probably damaging Het
Phrf1 C T 7: 141,258,812 T640M unknown Het
Psg18 T G 7: 18,349,316 T305P probably benign Het
Skil T A 3: 31,098,232 V301D probably damaging Het
Slc36a1 C A 11: 55,219,069 P68T probably damaging Het
Smim6 T C 11: 115,913,545 F53L probably benign Het
St5 G A 7: 109,531,130 A888V probably damaging Het
Tpgs2 G A 18: 25,168,595 T5M possibly damaging Het
Trrap T A 5: 144,828,600 V2523D probably benign Het
Usp9y A T Y: 1,432,197 D429E probably damaging Het
Vmn1r125 A G 7: 21,272,893 T239A probably benign Het
Vmn1r168 T C 7: 23,540,996 F93L probably damaging Het
Vmn1r88 A G 7: 13,178,476 N253S possibly damaging Het
Zfp644 C T 5: 106,636,477 A735T probably damaging Het
Other mutations in Olfr1271
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02386:Olfr1271 APN 2 90265951 missense probably damaging 0.97
IGL02901:Olfr1271 APN 2 90265708 missense probably damaging 1.00
PIT4468001:Olfr1271 UTSW 2 90266220 missense probably benign 0.00
R0325:Olfr1271 UTSW 2 90265536 missense probably null
R1350:Olfr1271 UTSW 2 90266346 missense probably damaging 0.97
R1888:Olfr1271 UTSW 2 90265569 missense probably damaging 1.00
R1888:Olfr1271 UTSW 2 90265569 missense probably damaging 1.00
R2509:Olfr1271 UTSW 2 90265686 missense possibly damaging 0.91
R2510:Olfr1271 UTSW 2 90265606 missense probably damaging 0.98
R4113:Olfr1271 UTSW 2 90266340 missense probably damaging 1.00
R5414:Olfr1271 UTSW 2 90265702 missense probably benign 0.07
R5580:Olfr1271 UTSW 2 90266350 missense probably benign 0.00
R5664:Olfr1271 UTSW 2 90265615 missense probably damaging 0.96
R5666:Olfr1271 UTSW 2 90265964 missense probably benign 0.04
R5670:Olfr1271 UTSW 2 90265964 missense probably benign 0.04
R5881:Olfr1271 UTSW 2 90266442 unclassified probably null
R6493:Olfr1271 UTSW 2 90265708 missense probably damaging 1.00
R7688:Olfr1271 UTSW 2 90265615 missense probably damaging 0.96
R7719:Olfr1271 UTSW 2 90266259 missense probably damaging 1.00
R8041:Olfr1271 UTSW 2 90266144 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCCATCATCACTAGCAAAATG -3'
(R):5'- CTTGTGCTGCAATGCTTTGAC -3'

Sequencing Primer
(F):5'- GCCATCATCACTAGCAAAATGATTTC -3'
(R):5'- TTTTCAGCTCTCCCATTATCTGATG -3'
Posted On2019-06-07