Incidental Mutation 'PIT4466001:Ccdc27'
ID555772
Institutional Source Beutler Lab
Gene Symbol Ccdc27
Ensembl Gene ENSMUSG00000039492
Gene Namecoiled-coil domain containing 27
SynonymsLOC381580
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #PIT4466001 (G1)
Quality Score174.009
Status Not validated
Chromosome4
Chromosomal Location154026639-154042677 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 154041727 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 102 (M102V)
Ref Sequence ENSEMBL: ENSMUSP00000039642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047207]
Predicted Effect unknown
Transcript: ENSMUST00000047207
AA Change: M102V
SMART Domains Protein: ENSMUSP00000039642
Gene: ENSMUSG00000039492
AA Change: M102V

DomainStartEndE-ValueType
low complexity region 39 53 N/A INTRINSIC
coiled coil region 203 243 N/A INTRINSIC
low complexity region 305 320 N/A INTRINSIC
low complexity region 329 358 N/A INTRINSIC
coiled coil region 390 575 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.9%
  • 10x: 85.1%
  • 20x: 72.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt C A 9: 99,620,560 P258T probably damaging Het
Adamts1 C A 16: 85,796,691 G719* probably null Het
Ano5 G T 7: 51,544,851 D111Y probably damaging Het
Arvcf T C 16: 18,402,949 V714A possibly damaging Het
AU021092 T A 16: 5,220,389 S85C probably damaging Het
C87414 A C 5: 93,636,288 L439R probably damaging Het
Capn5 T C 7: 98,123,988 D603G probably benign Het
Cbr1 T A 16: 93,609,804 V136E probably damaging Het
Ccr1 T C 9: 123,963,728 Y255C probably damaging Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 61,184,524 probably benign Het
Cep112 A G 11: 108,519,896 T553A probably benign Het
Chd7 C T 4: 8,753,101 L533F unknown Het
Cntnap1 T C 11: 101,177,305 F48L probably benign Het
Cyb5r3 T C 15: 83,161,863 D84G probably damaging Het
Ddx47 T C 6: 135,015,840 I154T probably benign Het
Dnah6 A G 6: 73,208,641 L99P probably benign Het
Dzank1 A G 2: 144,483,373 I558T probably benign Het
Fbn1 T C 2: 125,306,501 D2609G possibly damaging Het
Fhl5 C A 4: 25,211,194 C166F probably damaging Het
Fndc1 A G 17: 7,750,374 L1553P probably damaging Het
Frem1 G A 4: 82,972,137 T1035I probably benign Het
Gm3099 A G 14: 4,000,549 M128V probably benign Het
Gpaa1 C T 15: 76,334,740 T594I probably benign Het
Hck C T 2: 153,124,271 T55M probably damaging Het
Hectd4 T C 5: 121,333,060 probably null Het
Ica1l C T 1: 60,015,836 probably null Het
Ilf3 T C 9: 21,403,366 Y765H unknown Het
Mast4 G A 13: 102,804,718 T277M probably damaging Het
Mfsd6 T C 1: 52,708,897 T270A probably benign Het
Mib1 G A 18: 10,775,541 D498N probably benign Het
Naaladl1 A T 19: 6,114,633 T576S possibly damaging Het
Ncoa6 A T 2: 155,405,657 I1909N probably benign Het
Negr1 A G 3: 156,859,598 D107G probably benign Het
Nlrc4 A G 17: 74,427,119 M933T probably benign Het
Nmnat3 T G 9: 98,410,253 F184V probably benign Het
Olfr1271 A T 2: 90,266,295 V45E probably damaging Het
Olfr510 T C 7: 108,667,536 V40A possibly damaging Het
Olfr8 C A 10: 78,955,842 F212L probably benign Het
Olfr809 C T 10: 129,776,273 R120C probably benign Het
Pfkfb4 T C 9: 108,999,154 Y86H probably benign Het
Pgm5 T G 19: 24,824,329 Q178H probably damaging Het
Phrf1 C T 7: 141,258,812 T640M unknown Het
Psg18 T G 7: 18,349,316 T305P probably benign Het
Skil T A 3: 31,098,232 V301D probably damaging Het
Slc36a1 C A 11: 55,219,069 P68T probably damaging Het
Smim6 T C 11: 115,913,545 F53L probably benign Het
St5 G A 7: 109,531,130 A888V probably damaging Het
Tpgs2 G A 18: 25,168,595 T5M possibly damaging Het
Trrap T A 5: 144,828,600 V2523D probably benign Het
Usp9y A T Y: 1,432,197 D429E probably damaging Het
Vmn1r125 A G 7: 21,272,893 T239A probably benign Het
Vmn1r168 T C 7: 23,540,996 F93L probably damaging Het
Vmn1r88 A G 7: 13,178,476 N253S possibly damaging Het
Zfp644 C T 5: 106,636,477 A735T probably damaging Het
Other mutations in Ccdc27
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4472001:Ccdc27 UTSW 4 154041727 missense unknown
R0078:Ccdc27 UTSW 4 154035738 splice site probably benign
R0883:Ccdc27 UTSW 4 154036484 missense unknown
R1389:Ccdc27 UTSW 4 154041769 missense unknown
R1773:Ccdc27 UTSW 4 154041765 missense unknown
R1869:Ccdc27 UTSW 4 154026763 splice site probably null
R2020:Ccdc27 UTSW 4 154033313 missense probably null 0.05
R2070:Ccdc27 UTSW 4 154041813 missense unknown
R2131:Ccdc27 UTSW 4 154036306 small deletion probably benign
R3825:Ccdc27 UTSW 4 154036285 missense unknown
R4183:Ccdc27 UTSW 4 154036306 small deletion probably benign
R4254:Ccdc27 UTSW 4 154039519 missense unknown
R5932:Ccdc27 UTSW 4 154026774 missense probably benign 0.22
R6269:Ccdc27 UTSW 4 154037722 missense unknown
R6324:Ccdc27 UTSW 4 154036191 missense probably benign 0.02
R6761:Ccdc27 UTSW 4 154037698 missense unknown
R7090:Ccdc27 UTSW 4 154028066 missense probably benign 0.03
R7163:Ccdc27 UTSW 4 154032825 missense not run
R7488:Ccdc27 UTSW 4 154032967 missense probably benign 0.22
R7555:Ccdc27 UTSW 4 154041817 missense unknown
R7651:Ccdc27 UTSW 4 154028099 missense probably damaging 1.00
R7826:Ccdc27 UTSW 4 154039501 critical splice donor site probably null
R8250:Ccdc27 UTSW 4 154041788 missense unknown
R8815:Ccdc27 UTSW 4 154026748 missense probably benign 0.02
R8835:Ccdc27 UTSW 4 154042566 missense unknown
RF016:Ccdc27 UTSW 4 154036110 missense probably benign 0.04
Z1177:Ccdc27 UTSW 4 154036471 missense unknown
Predicted Primers
Posted On2019-06-07