Incidental Mutation 'PIT4466001:Trrap'
ID555776
Institutional Source Beutler Lab
Gene Symbol Trrap
Ensembl Gene ENSMUSG00000045482
Gene Nametransformation/transcription domain-associated protein
Synonymstransactivation/transformation-domain associated protein
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4466001 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location144767732-144859778 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 144828600 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 2523 (V2523D)
Ref Sequence ENSEMBL: ENSMUSP00000098035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038980] [ENSMUST00000094120] [ENSMUST00000100467] [ENSMUST00000213013]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038980
AA Change: V2523D

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000042544
Gene: ENSMUSG00000045482
AA Change: V2523D

DomainStartEndE-ValueType
low complexity region 482 527 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
Blast:PI3Kc 765 864 1e-13 BLAST
SCOP:d1gw5a_ 1184 1664 2e-6 SMART
low complexity region 1832 1843 N/A INTRINSIC
low complexity region 1866 1881 N/A INTRINSIC
low complexity region 2289 2303 N/A INTRINSIC
Pfam:FAT 2830 3174 4.7e-69 PFAM
low complexity region 3363 3376 N/A INTRINSIC
low complexity region 3407 3418 N/A INTRINSIC
PI3Kc 3509 3798 5.11e-8 SMART
FATC 3797 3829 1.89e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000094120
AA Change: V2541D

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000091668
Gene: ENSMUSG00000045482
AA Change: V2541D

DomainStartEndE-ValueType
low complexity region 482 527 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
Blast:PI3Kc 765 864 1e-13 BLAST
SCOP:d1gw5a_ 1184 1682 2e-6 SMART
low complexity region 1850 1861 N/A INTRINSIC
low complexity region 1884 1899 N/A INTRINSIC
low complexity region 2307 2321 N/A INTRINSIC
Pfam:FAT 2848 3203 1.1e-68 PFAM
low complexity region 3392 3405 N/A INTRINSIC
low complexity region 3436 3447 N/A INTRINSIC
PI3Kc 3538 3827 5.11e-8 SMART
FATC 3826 3858 1.89e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100467
AA Change: V2523D

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000098035
Gene: ENSMUSG00000045482
AA Change: V2523D

DomainStartEndE-ValueType
low complexity region 482 527 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
Blast:PI3Kc 765 864 1e-13 BLAST
SCOP:d1gw5a_ 1184 1664 2e-6 SMART
low complexity region 1832 1843 N/A INTRINSIC
low complexity region 1866 1881 N/A INTRINSIC
low complexity region 2289 2303 N/A INTRINSIC
Pfam:FAT 2830 3174 4.7e-69 PFAM
low complexity region 3381 3394 N/A INTRINSIC
low complexity region 3425 3436 N/A INTRINSIC
PI3Kc 3527 3816 5.11e-8 SMART
FATC 3815 3847 1.89e-3 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000122021
Gene: ENSMUSG00000045482
AA Change: V2262D

DomainStartEndE-ValueType
low complexity region 197 242 N/A INTRINSIC
low complexity region 244 255 N/A INTRINSIC
SCOP:d1gw5a_ 474 1003 9e-7 SMART
Blast:PI3Kc 480 579 1e-13 BLAST
low complexity region 1083 1092 N/A INTRINSIC
low complexity region 1572 1583 N/A INTRINSIC
low complexity region 1606 1621 N/A INTRINSIC
low complexity region 2029 2043 N/A INTRINSIC
Pfam:FAT 2570 2914 1.5e-69 PFAM
low complexity region 3121 3134 N/A INTRINSIC
low complexity region 3165 3176 N/A INTRINSIC
PI3Kc 3267 3556 5.11e-8 SMART
FATC 3555 3587 1.89e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000213013
AA Change: V2542D

PolyPhen 2 Score 0.748 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.9%
  • 10x: 85.1%
  • 20x: 72.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large multidomain protein of the phosphoinositide 3-kinase-related kinases (PIKK) family. The encoded protein is a common component of many histone acetyltransferase (HAT) complexes and plays a role in transcription and DNA repair by recruiting HAT complexes to chromatin. Deregulation of this gene may play a role in several types of cancer including glioblastoma multiforme. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous embryos die prior to E3.5 and exhibit embryonic and extraembryonic tissue disorganization. Mitotic abnormalities were also noted in homozygous cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt C A 9: 99,620,560 P258T probably damaging Het
Adamts1 C A 16: 85,796,691 G719* probably null Het
Ano5 G T 7: 51,544,851 D111Y probably damaging Het
Arvcf T C 16: 18,402,949 V714A possibly damaging Het
AU021092 T A 16: 5,220,389 S85C probably damaging Het
C87414 A C 5: 93,636,288 L439R probably damaging Het
Capn5 T C 7: 98,123,988 D603G probably benign Het
Cbr1 T A 16: 93,609,804 V136E probably damaging Het
Ccdc27 T C 4: 154,041,727 M102V unknown Het
Ccr1 T C 9: 123,963,728 Y255C probably damaging Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 61,184,524 probably benign Het
Cep112 A G 11: 108,519,896 T553A probably benign Het
Chd7 C T 4: 8,753,101 L533F unknown Het
Cntnap1 T C 11: 101,177,305 F48L probably benign Het
Cyb5r3 T C 15: 83,161,863 D84G probably damaging Het
Ddx47 T C 6: 135,015,840 I154T probably benign Het
Dnah6 A G 6: 73,208,641 L99P probably benign Het
Dzank1 A G 2: 144,483,373 I558T probably benign Het
Fbn1 T C 2: 125,306,501 D2609G possibly damaging Het
Fhl5 C A 4: 25,211,194 C166F probably damaging Het
Fndc1 A G 17: 7,750,374 L1553P probably damaging Het
Frem1 G A 4: 82,972,137 T1035I probably benign Het
Gm3099 A G 14: 4,000,549 M128V probably benign Het
Gpaa1 C T 15: 76,334,740 T594I probably benign Het
Hck C T 2: 153,124,271 T55M probably damaging Het
Hectd4 T C 5: 121,333,060 probably null Het
Ica1l C T 1: 60,015,836 probably null Het
Ilf3 T C 9: 21,403,366 Y765H unknown Het
Mast4 G A 13: 102,804,718 T277M probably damaging Het
Mfsd6 T C 1: 52,708,897 T270A probably benign Het
Mib1 G A 18: 10,775,541 D498N probably benign Het
Naaladl1 A T 19: 6,114,633 T576S possibly damaging Het
Ncoa6 A T 2: 155,405,657 I1909N probably benign Het
Negr1 A G 3: 156,859,598 D107G probably benign Het
Nlrc4 A G 17: 74,427,119 M933T probably benign Het
Nmnat3 T G 9: 98,410,253 F184V probably benign Het
Olfr1271 A T 2: 90,266,295 V45E probably damaging Het
Olfr510 T C 7: 108,667,536 V40A possibly damaging Het
Olfr8 C A 10: 78,955,842 F212L probably benign Het
Olfr809 C T 10: 129,776,273 R120C probably benign Het
Pfkfb4 T C 9: 108,999,154 Y86H probably benign Het
Pgm5 T G 19: 24,824,329 Q178H probably damaging Het
Phrf1 C T 7: 141,258,812 T640M unknown Het
Psg18 T G 7: 18,349,316 T305P probably benign Het
Skil T A 3: 31,098,232 V301D probably damaging Het
Slc36a1 C A 11: 55,219,069 P68T probably damaging Het
Smim6 T C 11: 115,913,545 F53L probably benign Het
St5 G A 7: 109,531,130 A888V probably damaging Het
Tpgs2 G A 18: 25,168,595 T5M possibly damaging Het
Usp9y A T Y: 1,432,197 D429E probably damaging Het
Vmn1r125 A G 7: 21,272,893 T239A probably benign Het
Vmn1r168 T C 7: 23,540,996 F93L probably damaging Het
Vmn1r88 A G 7: 13,178,476 N253S possibly damaging Het
Zfp644 C T 5: 106,636,477 A735T probably damaging Het
Other mutations in Trrap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Trrap APN 5 144779974 splice site probably benign
IGL00470:Trrap APN 5 144818038 missense probably damaging 1.00
IGL00490:Trrap APN 5 144825225 missense probably benign 0.40
IGL01072:Trrap APN 5 144784255 splice site probably benign
IGL01087:Trrap APN 5 144846539 missense probably damaging 0.99
IGL01300:Trrap APN 5 144804818 missense probably damaging 1.00
IGL01350:Trrap APN 5 144830969 missense possibly damaging 0.92
IGL01410:Trrap APN 5 144831021 missense probably benign 0.00
IGL01571:Trrap APN 5 144833287 splice site probably benign
IGL01748:Trrap APN 5 144833340 missense probably damaging 1.00
IGL01839:Trrap APN 5 144821875 missense probably damaging 1.00
IGL01976:Trrap APN 5 144856989 missense probably benign 0.00
IGL02075:Trrap APN 5 144828494 missense probably benign 0.00
IGL02127:Trrap APN 5 144816433 missense probably benign 0.22
IGL02131:Trrap APN 5 144840436 missense probably damaging 1.00
IGL02287:Trrap APN 5 144832538 missense probably damaging 1.00
IGL02301:Trrap APN 5 144777917 missense probably benign 0.05
IGL02336:Trrap APN 5 144798390 missense probably benign 0.39
IGL02526:Trrap APN 5 144824550 missense probably benign 0.00
IGL02873:Trrap APN 5 144841079 splice site probably benign
IGL02953:Trrap APN 5 144815964 missense probably damaging 0.99
IGL03404:Trrap APN 5 144833186 missense probably benign 0.00
Buffer UTSW 5 144834204 missense probably benign 0.06
Card-tower UTSW 5 144804766 missense probably damaging 1.00
Glass_house UTSW 5 144845477 missense possibly damaging 0.67
Immovable UTSW 5 144790855 missense possibly damaging 0.66
PIT4243001:Trrap UTSW 5 144796971 missense probably benign 0.00
R0062:Trrap UTSW 5 144782193 splice site probably benign
R0062:Trrap UTSW 5 144782193 splice site probably benign
R0112:Trrap UTSW 5 144822761 nonsense probably null
R0126:Trrap UTSW 5 144805750 nonsense probably null
R0257:Trrap UTSW 5 144804235 missense probably benign 0.31
R0325:Trrap UTSW 5 144816395 missense probably benign 0.05
R0376:Trrap UTSW 5 144816339 missense probably benign 0.03
R0396:Trrap UTSW 5 144814556 missense probably damaging 0.99
R0448:Trrap UTSW 5 144839567 missense possibly damaging 0.66
R0454:Trrap UTSW 5 144846477 missense probably damaging 1.00
R0711:Trrap UTSW 5 144853499 missense probably damaging 1.00
R0827:Trrap UTSW 5 144814830 missense probably benign 0.00
R1005:Trrap UTSW 5 144805727 missense probably damaging 1.00
R1147:Trrap UTSW 5 144804766 missense probably damaging 1.00
R1147:Trrap UTSW 5 144804766 missense probably damaging 1.00
R1179:Trrap UTSW 5 144777939 missense possibly damaging 0.94
R1218:Trrap UTSW 5 144816409 missense probably damaging 1.00
R1264:Trrap UTSW 5 144789599 splice site probably benign
R1374:Trrap UTSW 5 144846618 missense probably damaging 1.00
R1401:Trrap UTSW 5 144857422 missense possibly damaging 0.93
R1480:Trrap UTSW 5 144818313 missense probably benign
R1538:Trrap UTSW 5 144837202 missense possibly damaging 0.65
R1751:Trrap UTSW 5 144814575 critical splice donor site probably null
R1779:Trrap UTSW 5 144828590 missense probably benign 0.01
R1782:Trrap UTSW 5 144822703 missense possibly damaging 0.93
R1792:Trrap UTSW 5 144853586 missense possibly damaging 0.87
R1859:Trrap UTSW 5 144830951 missense probably benign 0.04
R1861:Trrap UTSW 5 144815917 splice site probably null
R1902:Trrap UTSW 5 144816053 missense probably damaging 1.00
R1903:Trrap UTSW 5 144816053 missense probably damaging 1.00
R2021:Trrap UTSW 5 144853488 missense possibly damaging 0.94
R2026:Trrap UTSW 5 144803044 missense possibly damaging 0.86
R2036:Trrap UTSW 5 144828562 missense probably benign 0.08
R2099:Trrap UTSW 5 144782239 missense possibly damaging 0.46
R2108:Trrap UTSW 5 144825874 missense probably benign 0.01
R2113:Trrap UTSW 5 144844211 missense probably damaging 1.00
R2174:Trrap UTSW 5 144821855 missense probably benign 0.40
R2442:Trrap UTSW 5 144817966 missense probably damaging 1.00
R2568:Trrap UTSW 5 144843369 critical splice donor site probably null
R3442:Trrap UTSW 5 144792252 missense probably benign 0.03
R3853:Trrap UTSW 5 144792165 missense probably damaging 1.00
R4401:Trrap UTSW 5 144843318 missense possibly damaging 0.60
R4493:Trrap UTSW 5 144831048 missense probably benign 0.21
R4524:Trrap UTSW 5 144825321 missense probably benign 0.38
R4569:Trrap UTSW 5 144792118 missense probably benign 0.13
R4672:Trrap UTSW 5 144785480 missense probably damaging 0.97
R4732:Trrap UTSW 5 144816570 missense probably damaging 1.00
R4733:Trrap UTSW 5 144816570 missense probably damaging 1.00
R4791:Trrap UTSW 5 144803277 missense probably damaging 1.00
R4795:Trrap UTSW 5 144832488 missense probably benign 0.06
R4827:Trrap UTSW 5 144800948 missense probably benign 0.02
R4839:Trrap UTSW 5 144845592 missense probably damaging 1.00
R4915:Trrap UTSW 5 144805735 missense probably damaging 0.99
R4951:Trrap UTSW 5 144805720 missense possibly damaging 0.65
R4959:Trrap UTSW 5 144856960 missense probably damaging 1.00
R5049:Trrap UTSW 5 144826717 missense probably damaging 1.00
R5074:Trrap UTSW 5 144851179 missense probably damaging 1.00
R5236:Trrap UTSW 5 144817786 missense probably benign 0.07
R5281:Trrap UTSW 5 144813503 missense probably benign 0.13
R5322:Trrap UTSW 5 144844224 missense probably damaging 1.00
R5457:Trrap UTSW 5 144849977 missense probably damaging 1.00
R5590:Trrap UTSW 5 144782265 missense probably benign 0.05
R5799:Trrap UTSW 5 144830945 missense probably benign
R5885:Trrap UTSW 5 144794793 missense probably damaging 1.00
R5905:Trrap UTSW 5 144849920 missense possibly damaging 0.95
R5908:Trrap UTSW 5 144786708 missense probably damaging 0.96
R5956:Trrap UTSW 5 144807391 splice site silent
R5992:Trrap UTSW 5 144810184 missense probably benign 0.00
R6017:Trrap UTSW 5 144844241 missense probably damaging 1.00
R6029:Trrap UTSW 5 144817679 missense possibly damaging 0.94
R6029:Trrap UTSW 5 144825914 missense possibly damaging 0.75
R6117:Trrap UTSW 5 144802961 missense possibly damaging 0.78
R6166:Trrap UTSW 5 144781981 missense possibly damaging 0.66
R6234:Trrap UTSW 5 144839713 splice site probably null
R6288:Trrap UTSW 5 144811992 missense probably damaging 1.00
R6290:Trrap UTSW 5 144805018 missense probably damaging 1.00
R6316:Trrap UTSW 5 144813526 missense probably benign 0.02
R6398:Trrap UTSW 5 144790870 missense possibly damaging 0.83
R6413:Trrap UTSW 5 144784046 missense possibly damaging 0.83
R6499:Trrap UTSW 5 144857002 missense probably damaging 1.00
R6529:Trrap UTSW 5 144834204 missense probably benign 0.06
R6574:Trrap UTSW 5 144815550 critical splice donor site probably null
R6631:Trrap UTSW 5 144771650 missense possibly damaging 0.94
R6727:Trrap UTSW 5 144856950 missense probably damaging 1.00
R6776:Trrap UTSW 5 144851256 nonsense probably null
R6914:Trrap UTSW 5 144784043 missense possibly damaging 0.83
R6942:Trrap UTSW 5 144784043 missense possibly damaging 0.83
R6945:Trrap UTSW 5 144790855 missense possibly damaging 0.66
R7023:Trrap UTSW 5 144792154 missense possibly damaging 0.64
R7107:Trrap UTSW 5 144797135 missense probably benign 0.05
R7139:Trrap UTSW 5 144803178 missense possibly damaging 0.65
R7148:Trrap UTSW 5 144821803 missense possibly damaging 0.77
R7167:Trrap UTSW 5 144839614 missense probably benign 0.39
R7171:Trrap UTSW 5 144794049 missense probably damaging 1.00
R7205:Trrap UTSW 5 144842707 missense possibly damaging 0.94
R7215:Trrap UTSW 5 144797135 missense probably benign 0.05
R7255:Trrap UTSW 5 144858954 missense probably damaging 1.00
R7261:Trrap UTSW 5 144845477 missense possibly damaging 0.67
R7264:Trrap UTSW 5 144814523 missense probably benign 0.05
R7372:Trrap UTSW 5 144789398 missense probably benign
R7447:Trrap UTSW 5 144839474 missense probably damaging 0.97
R7449:Trrap UTSW 5 144851209 missense probably damaging 1.00
R7655:Trrap UTSW 5 144842612 missense probably damaging 1.00
R7656:Trrap UTSW 5 144842612 missense probably damaging 1.00
R7662:Trrap UTSW 5 144832511 missense probably benign 0.00
R7716:Trrap UTSW 5 144777146 missense possibly damaging 0.73
R8143:Trrap UTSW 5 144835897 splice site probably null
R8183:Trrap UTSW 5 144828533 missense probably benign 0.01
R8265:Trrap UTSW 5 144785534 missense possibly damaging 0.53
R8273:Trrap UTSW 5 144791165 missense probably damaging 1.00
R8556:Trrap UTSW 5 144825937 missense probably benign 0.44
X0060:Trrap UTSW 5 144843361 missense probably damaging 0.96
Z1088:Trrap UTSW 5 144834197 missense probably benign 0.00
Z1177:Trrap UTSW 5 144810344 missense
Z1177:Trrap UTSW 5 144819708 missense probably damaging 1.00
Z1177:Trrap UTSW 5 144856951 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCGTTAAACTGATCTTTCCC -3'
(R):5'- TACAGCATCACAGCAGAGGG -3'

Sequencing Primer
(F):5'- GCGTTAAACTGATCTTTCCCCATGG -3'
(R):5'- TGGACATGCCAAATGAGATGCTTTTC -3'
Posted On2019-06-07