Incidental Mutation 'PIT4466001:Psg18'
ID 555780
Institutional Source Beutler Lab
Gene Symbol Psg18
Ensembl Gene ENSMUSG00000003505
Gene Name pregnancy specific glycoprotein 18
Synonyms Cea-3, Cea3, mmCGM6
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock # PIT4466001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 18345422-18355009 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 18349316 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 305 (T305P)
Ref Sequence ENSEMBL: ENSMUSP00000003597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003597] [ENSMUST00000098783]
AlphaFold B2RSG7
Predicted Effect probably benign
Transcript: ENSMUST00000003597
AA Change: T305P

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000003597
Gene: ENSMUSG00000003505
AA Change: T305P

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
IG 40 140 2.11e-2 SMART
IG 161 262 1.03e0 SMART
IG 281 380 2.15e-3 SMART
IGc2 398 462 1.58e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000098783
AA Change: T184P

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000096380
Gene: ENSMUSG00000003505
AA Change: T184P

DomainStartEndE-ValueType
IG 40 141 1.03e0 SMART
IG 160 259 2.15e-3 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.9%
  • 10x: 85.1%
  • 20x: 72.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt C A 9: 99,620,560 P258T probably damaging Het
Adamts1 C A 16: 85,796,691 G719* probably null Het
Ano5 G T 7: 51,544,851 D111Y probably damaging Het
Arvcf T C 16: 18,402,949 V714A possibly damaging Het
AU021092 T A 16: 5,220,389 S85C probably damaging Het
C87414 A C 5: 93,636,288 L439R probably damaging Het
Capn5 T C 7: 98,123,988 D603G probably benign Het
Cbr1 T A 16: 93,609,804 V136E probably damaging Het
Ccdc27 T C 4: 154,041,727 M102V unknown Het
Ccr1 T C 9: 123,963,728 Y255C probably damaging Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 61,184,524 probably benign Het
Cep112 A G 11: 108,519,896 T553A probably benign Het
Chd7 C T 4: 8,753,101 L533F unknown Het
Cntnap1 T C 11: 101,177,305 F48L probably benign Het
Cyb5r3 T C 15: 83,161,863 D84G probably damaging Het
Ddx47 T C 6: 135,015,840 I154T probably benign Het
Dnah6 A G 6: 73,208,641 L99P probably benign Het
Dzank1 A G 2: 144,483,373 I558T probably benign Het
Fbn1 T C 2: 125,306,501 D2609G possibly damaging Het
Fhl5 C A 4: 25,211,194 C166F probably damaging Het
Fndc1 A G 17: 7,750,374 L1553P probably damaging Het
Frem1 G A 4: 82,972,137 T1035I probably benign Het
Gm3099 A G 14: 4,000,549 M128V probably benign Het
Gpaa1 C T 15: 76,334,740 T594I probably benign Het
Hck C T 2: 153,124,271 T55M probably damaging Het
Hectd4 T C 5: 121,333,060 probably null Het
Ica1l C T 1: 60,015,836 probably null Het
Ilf3 T C 9: 21,403,366 Y765H unknown Het
Mast4 G A 13: 102,804,718 T277M probably damaging Het
Mfsd6 T C 1: 52,708,897 T270A probably benign Het
Mib1 G A 18: 10,775,541 D498N probably benign Het
Naaladl1 A T 19: 6,114,633 T576S possibly damaging Het
Ncoa6 A T 2: 155,405,657 I1909N probably benign Het
Negr1 A G 3: 156,859,598 D107G probably benign Het
Nlrc4 A G 17: 74,427,119 M933T probably benign Het
Nmnat3 T G 9: 98,410,253 F184V probably benign Het
Olfr1271 A T 2: 90,266,295 V45E probably damaging Het
Olfr510 T C 7: 108,667,536 V40A possibly damaging Het
Olfr8 C A 10: 78,955,842 F212L probably benign Het
Olfr809 C T 10: 129,776,273 R120C probably benign Het
Pfkfb4 T C 9: 108,999,154 Y86H probably benign Het
Pgm5 T G 19: 24,824,329 Q178H probably damaging Het
Phrf1 C T 7: 141,258,812 T640M unknown Het
Skil T A 3: 31,098,232 V301D probably damaging Het
Slc36a1 C A 11: 55,219,069 P68T probably damaging Het
Smim6 T C 11: 115,913,545 F53L probably benign Het
St5 G A 7: 109,531,130 A888V probably damaging Het
Tpgs2 G A 18: 25,168,595 T5M possibly damaging Het
Trrap T A 5: 144,828,600 V2523D probably benign Het
Usp9y A T Y: 1,432,197 D429E probably damaging Het
Vmn1r125 A G 7: 21,272,893 T239A probably benign Het
Vmn1r168 T C 7: 23,540,996 F93L probably damaging Het
Vmn1r88 A G 7: 13,178,476 N253S possibly damaging Het
Zfp644 C T 5: 106,636,477 A735T probably damaging Het
Other mutations in Psg18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Psg18 APN 7 18354816 start codon destroyed probably null 0.99
IGL01748:Psg18 APN 7 18353551 missense probably benign 0.05
IGL01767:Psg18 APN 7 18353397 missense possibly damaging 0.80
IGL02727:Psg18 APN 7 18345950 missense probably damaging 1.00
IGL02744:Psg18 APN 7 18349402 missense probably benign 0.38
G1Funyon:Psg18 UTSW 7 18353377 missense probably damaging 0.99
R0331:Psg18 UTSW 7 18353308 missense probably benign 0.03
R1077:Psg18 UTSW 7 18351075 missense possibly damaging 0.84
R1171:Psg18 UTSW 7 18346079 missense probably benign 0.10
R1173:Psg18 UTSW 7 18354817 start codon destroyed probably null 0.97
R1234:Psg18 UTSW 7 18349190 missense probably damaging 1.00
R1553:Psg18 UTSW 7 18353481 missense probably benign 0.19
R1632:Psg18 UTSW 7 18350899 missense probably benign 0.02
R2108:Psg18 UTSW 7 18350874 missense probably damaging 1.00
R2439:Psg18 UTSW 7 18346119 missense probably benign 0.24
R3032:Psg18 UTSW 7 18350979 missense probably benign 0.01
R3053:Psg18 UTSW 7 18349193 missense probably damaging 1.00
R3432:Psg18 UTSW 7 18349171 missense possibly damaging 0.61
R3725:Psg18 UTSW 7 18354823 start gained probably benign
R4479:Psg18 UTSW 7 18350862 missense probably benign 0.01
R4480:Psg18 UTSW 7 18350862 missense probably benign 0.01
R4846:Psg18 UTSW 7 18350786 nonsense probably null
R4858:Psg18 UTSW 7 18353484 missense possibly damaging 0.49
R5010:Psg18 UTSW 7 18349354 missense probably damaging 1.00
R5225:Psg18 UTSW 7 18345949 missense probably damaging 1.00
R5450:Psg18 UTSW 7 18353425 missense probably benign 0.32
R5526:Psg18 UTSW 7 18349348 missense probably damaging 1.00
R5840:Psg18 UTSW 7 18346602 intron probably benign
R6409:Psg18 UTSW 7 18353521 missense probably benign
R7164:Psg18 UTSW 7 18350937 missense possibly damaging 0.89
R7276:Psg18 UTSW 7 18345984 missense probably damaging 0.99
R7768:Psg18 UTSW 7 18346028 missense probably damaging 1.00
R8301:Psg18 UTSW 7 18353377 missense probably damaging 0.99
R8700:Psg18 UTSW 7 18353625 missense probably damaging 1.00
R8982:Psg18 UTSW 7 18349375 missense probably benign 0.20
R9042:Psg18 UTSW 7 18349122 missense probably benign 0.44
R9054:Psg18 UTSW 7 18353525 missense possibly damaging 0.82
Z1176:Psg18 UTSW 7 18354787 missense probably benign 0.07
Z1177:Psg18 UTSW 7 18349115 missense probably benign 0.30
Z1177:Psg18 UTSW 7 18349198 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GCTGTTACAACTCTCACATTGC -3'
(R):5'- GCAGGTCACCATCTTTCCAC -3'

Sequencing Primer
(F):5'- GTTATTAGTGTGTATAAGCCAGAGTC -3'
(R):5'- ACCTAGCACAATGATCCCTTCTG -3'
Posted On 2019-06-07