Incidental Mutation 'PIT4466001:Capn5'
ID 555784
Institutional Source Beutler Lab
Gene Symbol Capn5
Ensembl Gene ENSMUSG00000035547
Gene Name calpain 5
Synonyms
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # PIT4466001 (G1)
Quality Score 129.008
Status Not validated
Chromosome 7
Chromosomal Location 97770766-97827481 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 97773195 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 603 (D603G)
Ref Sequence ENSEMBL: ENSMUSP00000048183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040971] [ENSMUST00000107112] [ENSMUST00000107127] [ENSMUST00000107128] [ENSMUST00000138627]
AlphaFold O08688
Predicted Effect probably benign
Transcript: ENSMUST00000040971
AA Change: D603G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000048183
Gene: ENSMUSG00000035547
AA Change: D603G

DomainStartEndE-ValueType
CysPc 8 351 4.18e-212 SMART
calpain_III 353 496 1.21e-66 SMART
C2 518 619 1.29e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107112
AA Change: D603G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102729
Gene: ENSMUSG00000035547
AA Change: D603G

DomainStartEndE-ValueType
CysPc 8 351 4.18e-212 SMART
calpain_III 353 496 1.21e-66 SMART
C2 518 619 1.29e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107127
SMART Domains Protein: ENSMUSP00000102744
Gene: ENSMUSG00000030761

DomainStartEndE-ValueType
MYSc 59 742 N/A SMART
IQ 743 765 2.99e0 SMART
IQ 766 788 8.77e-7 SMART
IQ 812 834 8e0 SMART
IQ 835 857 8.7e0 SMART
low complexity region 865 900 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
MyTH4 1017 1253 1.4e-71 SMART
B41 1254 1469 8.82e-42 SMART
SH3 1568 1633 4.93e-7 SMART
MyTH4 1709 1858 3.95e-57 SMART
B41 1860 2077 8.27e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107128
SMART Domains Protein: ENSMUSP00000102745
Gene: ENSMUSG00000030761

DomainStartEndE-ValueType
MYSc 59 742 N/A SMART
IQ 743 765 2.99e0 SMART
IQ 766 788 8.77e-7 SMART
IQ 812 834 8e0 SMART
IQ 835 857 8.7e0 SMART
low complexity region 865 900 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
MyTH4 1017 1253 1.4e-71 SMART
B41 1254 1469 8.82e-42 SMART
SH3 1606 1671 4.93e-7 SMART
MyTH4 1747 1896 3.95e-57 SMART
B41 1898 2115 8.27e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138627
SMART Domains Protein: ENSMUSP00000114944
Gene: ENSMUSG00000030761

DomainStartEndE-ValueType
Pfam:Myosin_head 67 139 7.1e-20 PFAM
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.9%
  • 10x: 85.1%
  • 20x: 72.5%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the calpain family of proteins. Unlike many members of the calpain gene family, this gene lacks a calmodulin-like domain, required for calcium binding. Mouse models for Huntington's disease displayed increased levels of the protein encoded by this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for one allele of this gene occasionally exhibit reduced viability but are usually normal. Homozygotes for another allele die as embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt C A 9: 99,502,613 (GRCm39) P258T probably damaging Het
Adamts1 C A 16: 85,593,579 (GRCm39) G719* probably null Het
Ano5 G T 7: 51,194,599 (GRCm39) D111Y probably damaging Het
Arvcf T C 16: 18,221,699 (GRCm39) V714A possibly damaging Het
AU021092 T A 16: 5,038,253 (GRCm39) S85C probably damaging Het
Cbr1 T A 16: 93,406,692 (GRCm39) V136E probably damaging Het
Ccdc27 T C 4: 154,126,184 (GRCm39) M102V unknown Het
Ccr1 T C 9: 123,763,765 (GRCm39) Y255C probably damaging Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 60,228,130 (GRCm39) probably benign Het
Cep112 A G 11: 108,410,722 (GRCm39) T553A probably benign Het
Chd7 C T 4: 8,753,101 (GRCm39) L533F unknown Het
Cntnap1 T C 11: 101,068,131 (GRCm39) F48L probably benign Het
Cyb5r3 T C 15: 83,046,064 (GRCm39) D84G probably damaging Het
Ddx47 T C 6: 134,992,803 (GRCm39) I154T probably benign Het
Dennd2b G A 7: 109,130,337 (GRCm39) A888V probably damaging Het
Dnah6 A G 6: 73,185,624 (GRCm39) L99P probably benign Het
Dzank1 A G 2: 144,325,293 (GRCm39) I558T probably benign Het
Fbn1 T C 2: 125,148,421 (GRCm39) D2609G possibly damaging Het
Fhl5 C A 4: 25,211,194 (GRCm39) C166F probably damaging Het
Fndc1 A G 17: 7,969,206 (GRCm39) L1553P probably damaging Het
Frem1 G A 4: 82,890,374 (GRCm39) T1035I probably benign Het
Gm3099 A G 14: 15,346,517 (GRCm39) M128V probably benign Het
Gpaa1 C T 15: 76,218,940 (GRCm39) T594I probably benign Het
Hck C T 2: 152,966,191 (GRCm39) T55M probably damaging Het
Hectd4 T C 5: 121,471,123 (GRCm39) probably null Het
Ica1l C T 1: 60,054,995 (GRCm39) probably null Het
Ilf3 T C 9: 21,314,662 (GRCm39) Y765H unknown Het
Mast4 G A 13: 102,941,226 (GRCm39) T277M probably damaging Het
Mfsd6 T C 1: 52,748,056 (GRCm39) T270A probably benign Het
Mib1 G A 18: 10,775,541 (GRCm39) D498N probably benign Het
Naaladl1 A T 19: 6,164,663 (GRCm39) T576S possibly damaging Het
Ncoa6 A T 2: 155,247,577 (GRCm39) I1909N probably benign Het
Negr1 A G 3: 156,565,235 (GRCm39) D107G probably benign Het
Nlrc4 A G 17: 74,734,114 (GRCm39) M933T probably benign Het
Nmnat3 T G 9: 98,292,306 (GRCm39) F184V probably benign Het
Or4b12 A T 2: 90,096,639 (GRCm39) V45E probably damaging Het
Or5p81 T C 7: 108,266,743 (GRCm39) V40A possibly damaging Het
Or6c76 C T 10: 129,612,142 (GRCm39) R120C probably benign Het
Or7a42 C A 10: 78,791,676 (GRCm39) F212L probably benign Het
Pfkfb4 T C 9: 108,828,222 (GRCm39) Y86H probably benign Het
Pgm5 T G 19: 24,801,693 (GRCm39) Q178H probably damaging Het
Phrf1 C T 7: 140,838,725 (GRCm39) T640M unknown Het
Pramel34 A C 5: 93,784,147 (GRCm39) L439R probably damaging Het
Psg18 T G 7: 18,083,241 (GRCm39) T305P probably benign Het
Skil T A 3: 31,152,381 (GRCm39) V301D probably damaging Het
Slc36a1 C A 11: 55,109,895 (GRCm39) P68T probably damaging Het
Smim6 T C 11: 115,804,371 (GRCm39) F53L probably benign Het
Tpgs2 G A 18: 25,301,652 (GRCm39) T5M possibly damaging Het
Trrap T A 5: 144,765,410 (GRCm39) V2523D probably benign Het
Usp9y A T Y: 1,432,197 (GRCm39) D429E probably damaging Het
Vmn1r125 A G 7: 21,006,818 (GRCm39) T239A probably benign Het
Vmn1r168 T C 7: 23,240,421 (GRCm39) F93L probably damaging Het
Vmn1r88 A G 7: 12,912,403 (GRCm39) N253S possibly damaging Het
Zfp644 C T 5: 106,784,343 (GRCm39) A735T probably damaging Het
Other mutations in Capn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Capn5 APN 7 97,784,971 (GRCm39) missense probably damaging 1.00
IGL01311:Capn5 APN 7 97,811,130 (GRCm39) missense probably damaging 1.00
IGL01768:Capn5 APN 7 97,774,480 (GRCm39) missense probably damaging 1.00
IGL01926:Capn5 APN 7 97,777,679 (GRCm39) critical splice donor site probably null
IGL02076:Capn5 APN 7 97,780,950 (GRCm39) nonsense probably null
IGL02505:Capn5 APN 7 97,780,403 (GRCm39) missense possibly damaging 0.85
BB007:Capn5 UTSW 7 97,773,085 (GRCm39) missense probably benign
BB017:Capn5 UTSW 7 97,773,085 (GRCm39) missense probably benign
R0178:Capn5 UTSW 7 97,782,098 (GRCm39) missense probably damaging 1.00
R0518:Capn5 UTSW 7 97,782,089 (GRCm39) missense probably damaging 1.00
R0521:Capn5 UTSW 7 97,782,089 (GRCm39) missense probably damaging 1.00
R1459:Capn5 UTSW 7 97,781,049 (GRCm39) missense possibly damaging 0.84
R2005:Capn5 UTSW 7 97,778,570 (GRCm39) missense probably benign
R2258:Capn5 UTSW 7 97,785,082 (GRCm39) missense probably damaging 0.99
R2327:Capn5 UTSW 7 97,775,574 (GRCm39) missense probably benign 0.07
R3797:Capn5 UTSW 7 97,775,036 (GRCm39) missense probably null 0.77
R4032:Capn5 UTSW 7 97,778,453 (GRCm39) missense probably damaging 0.96
R4620:Capn5 UTSW 7 97,778,578 (GRCm39) missense probably damaging 0.98
R4717:Capn5 UTSW 7 97,773,126 (GRCm39) missense probably benign 0.02
R4777:Capn5 UTSW 7 97,780,925 (GRCm39) missense probably damaging 1.00
R4823:Capn5 UTSW 7 97,775,648 (GRCm39) missense probably damaging 1.00
R4841:Capn5 UTSW 7 97,780,879 (GRCm39) splice site probably null
R4965:Capn5 UTSW 7 97,775,624 (GRCm39) missense probably damaging 0.99
R5568:Capn5 UTSW 7 97,775,137 (GRCm39) missense probably damaging 1.00
R5732:Capn5 UTSW 7 97,778,593 (GRCm39) missense possibly damaging 0.95
R5792:Capn5 UTSW 7 97,780,402 (GRCm39) missense probably benign 0.09
R6892:Capn5 UTSW 7 97,785,148 (GRCm39) missense probably damaging 1.00
R6923:Capn5 UTSW 7 97,778,461 (GRCm39) missense probably damaging 1.00
R7095:Capn5 UTSW 7 97,775,038 (GRCm39) missense probably benign 0.10
R7391:Capn5 UTSW 7 97,780,426 (GRCm39) missense probably benign 0.02
R7553:Capn5 UTSW 7 97,773,231 (GRCm39) missense probably damaging 1.00
R7930:Capn5 UTSW 7 97,773,085 (GRCm39) missense probably benign
R8876:Capn5 UTSW 7 97,780,902 (GRCm39) missense probably benign 0.01
R8914:Capn5 UTSW 7 97,784,997 (GRCm39) missense probably damaging 0.99
R9012:Capn5 UTSW 7 97,814,050 (GRCm39) start gained probably benign
R9087:Capn5 UTSW 7 97,775,531 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGACGGGAATTCTTTGGGG -3'
(R):5'- GTGAAGAGGCTTCTAGGTCC -3'

Sequencing Primer
(F):5'- TCTCTTCAGGTCACACAGTGGG -3'
(R):5'- AGGCTTCTAGGTCCGGCTG -3'
Posted On 2019-06-07