Incidental Mutation 'PIT4466001:St5'
ID555786
Institutional Source Beutler Lab
Gene Symbol St5
Ensembl Gene ENSMUSG00000031024
Gene Namesuppression of tumorigenicity 5
Synonyms2610305K15Rik, 2010004M01Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.746) question?
Stock #PIT4466001 (G1)
Quality Score221.999
Status Not validated
Chromosome7
Chromosomal Location109523911-109703605 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 109531130 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 888 (A888V)
Ref Sequence ENSEMBL: ENSMUSP00000077067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077909] [ENSMUST00000079282] [ENSMUST00000084738] [ENSMUST00000168005]
Predicted Effect probably damaging
Transcript: ENSMUST00000077909
AA Change: A888V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077067
Gene: ENSMUSG00000031024
AA Change: A888V

DomainStartEndE-ValueType
low complexity region 28 46 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 314 326 N/A INTRINSIC
low complexity region 327 348 N/A INTRINSIC
low complexity region 365 379 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
low complexity region 577 609 N/A INTRINSIC
low complexity region 624 638 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
uDENN 690 781 1.16e-30 SMART
DENN 788 972 7.84e-78 SMART
low complexity region 1007 1014 N/A INTRINSIC
dDENN 1019 1086 3.12e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000079282
AA Change: A888V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078264
Gene: ENSMUSG00000031024
AA Change: A888V

DomainStartEndE-ValueType
low complexity region 28 46 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 314 326 N/A INTRINSIC
low complexity region 327 348 N/A INTRINSIC
low complexity region 365 379 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
low complexity region 577 609 N/A INTRINSIC
low complexity region 624 638 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
uDENN 690 781 1.16e-30 SMART
DENN 788 972 7.84e-78 SMART
low complexity region 1007 1014 N/A INTRINSIC
dDENN 1019 1086 3.12e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000084738
AA Change: A471V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000081789
Gene: ENSMUSG00000031024
AA Change: A471V

DomainStartEndE-ValueType
low complexity region 160 192 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
low complexity region 228 239 N/A INTRINSIC
uDENN 273 364 1.16e-30 SMART
DENN 371 555 7.84e-78 SMART
low complexity region 590 597 N/A INTRINSIC
dDENN 602 669 3.12e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168005
AA Change: A471V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130119
Gene: ENSMUSG00000031024
AA Change: A471V

DomainStartEndE-ValueType
low complexity region 160 192 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
low complexity region 228 239 N/A INTRINSIC
uDENN 273 364 1.16e-30 SMART
DENN 371 555 7.84e-78 SMART
low complexity region 590 597 N/A INTRINSIC
dDENN 602 669 3.12e-22 SMART
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.9%
  • 10x: 85.1%
  • 20x: 72.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its ability to suppress the tumorigenicity of Hela cells in nude mice. The protein encoded by this gene contains a C-terminal region that shares similarity with the Rab 3 family of small GTP binding proteins. This protein preferentially binds to the SH3 domain of c-Abl kinase, and acts as a regulator of MAPK1/ERK2 kinase, which may contribute to its ability to reduce the tumorigenic phenotype in cells. Three alternatively spliced transcript variants of this gene encoding distinct isoforms are identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt C A 9: 99,620,560 P258T probably damaging Het
Adamts1 C A 16: 85,796,691 G719* probably null Het
Ano5 G T 7: 51,544,851 D111Y probably damaging Het
Arvcf T C 16: 18,402,949 V714A possibly damaging Het
AU021092 T A 16: 5,220,389 S85C probably damaging Het
C87414 A C 5: 93,636,288 L439R probably damaging Het
Capn5 T C 7: 98,123,988 D603G probably benign Het
Cbr1 T A 16: 93,609,804 V136E probably damaging Het
Ccdc27 T C 4: 154,041,727 M102V unknown Het
Ccr1 T C 9: 123,963,728 Y255C probably damaging Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 61,184,524 probably benign Het
Cep112 A G 11: 108,519,896 T553A probably benign Het
Chd7 C T 4: 8,753,101 L533F unknown Het
Cntnap1 T C 11: 101,177,305 F48L probably benign Het
Cyb5r3 T C 15: 83,161,863 D84G probably damaging Het
Ddx47 T C 6: 135,015,840 I154T probably benign Het
Dnah6 A G 6: 73,208,641 L99P probably benign Het
Dzank1 A G 2: 144,483,373 I558T probably benign Het
Fbn1 T C 2: 125,306,501 D2609G possibly damaging Het
Fhl5 C A 4: 25,211,194 C166F probably damaging Het
Fndc1 A G 17: 7,750,374 L1553P probably damaging Het
Frem1 G A 4: 82,972,137 T1035I probably benign Het
Gm3099 A G 14: 4,000,549 M128V probably benign Het
Gpaa1 C T 15: 76,334,740 T594I probably benign Het
Hck C T 2: 153,124,271 T55M probably damaging Het
Hectd4 T C 5: 121,333,060 probably null Het
Ica1l C T 1: 60,015,836 probably null Het
Ilf3 T C 9: 21,403,366 Y765H unknown Het
Mast4 G A 13: 102,804,718 T277M probably damaging Het
Mfsd6 T C 1: 52,708,897 T270A probably benign Het
Mib1 G A 18: 10,775,541 D498N probably benign Het
Naaladl1 A T 19: 6,114,633 T576S possibly damaging Het
Ncoa6 A T 2: 155,405,657 I1909N probably benign Het
Negr1 A G 3: 156,859,598 D107G probably benign Het
Nlrc4 A G 17: 74,427,119 M933T probably benign Het
Nmnat3 T G 9: 98,410,253 F184V probably benign Het
Olfr1271 A T 2: 90,266,295 V45E probably damaging Het
Olfr510 T C 7: 108,667,536 V40A possibly damaging Het
Olfr8 C A 10: 78,955,842 F212L probably benign Het
Olfr809 C T 10: 129,776,273 R120C probably benign Het
Pfkfb4 T C 9: 108,999,154 Y86H probably benign Het
Pgm5 T G 19: 24,824,329 Q178H probably damaging Het
Phrf1 C T 7: 141,258,812 T640M unknown Het
Psg18 T G 7: 18,349,316 T305P probably benign Het
Skil T A 3: 31,098,232 V301D probably damaging Het
Slc36a1 C A 11: 55,219,069 P68T probably damaging Het
Smim6 T C 11: 115,913,545 F53L probably benign Het
Tpgs2 G A 18: 25,168,595 T5M possibly damaging Het
Trrap T A 5: 144,828,600 V2523D probably benign Het
Usp9y A T Y: 1,432,197 D429E probably damaging Het
Vmn1r125 A G 7: 21,272,893 T239A probably benign Het
Vmn1r168 T C 7: 23,540,996 F93L probably damaging Het
Vmn1r88 A G 7: 13,178,476 N253S possibly damaging Het
Zfp644 C T 5: 106,636,477 A735T probably damaging Het
Other mutations in St5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:St5 APN 7 109527708 missense possibly damaging 0.71
IGL01132:St5 APN 7 109570005 unclassified probably null
IGL01288:St5 APN 7 109539822 missense probably damaging 0.96
IGL01645:St5 APN 7 109527634 nonsense probably null
IGL01714:St5 APN 7 109570062 missense probably damaging 0.99
IGL02021:St5 APN 7 109557372 missense probably damaging 1.00
IGL02302:St5 APN 7 109525331 missense probably damaging 1.00
IGL02496:St5 APN 7 109556235 missense possibly damaging 0.83
IGL02795:St5 APN 7 109556364 missense probably damaging 1.00
FR4340:St5 UTSW 7 109556921 unclassified probably benign
FR4737:St5 UTSW 7 109556921 unclassified probably benign
PIT4469001:St5 UTSW 7 109531130 missense probably damaging 1.00
PIT4472001:St5 UTSW 7 109531130 missense probably damaging 1.00
R0024:St5 UTSW 7 109524659 missense probably damaging 1.00
R0124:St5 UTSW 7 109542511 missense possibly damaging 0.66
R0125:St5 UTSW 7 109556338 missense probably benign 0.19
R0365:St5 UTSW 7 109538949 missense probably damaging 1.00
R0491:St5 UTSW 7 109557204 missense probably benign 0.45
R0534:St5 UTSW 7 109541428 missense probably damaging 1.00
R0662:St5 UTSW 7 109557426 missense probably damaging 1.00
R0743:St5 UTSW 7 109557345 missense probably damaging 1.00
R0772:St5 UTSW 7 109542320 splice site probably null
R0774:St5 UTSW 7 109542320 splice site probably null
R0787:St5 UTSW 7 109525620 missense possibly damaging 0.94
R0884:St5 UTSW 7 109557345 missense probably damaging 1.00
R1518:St5 UTSW 7 109557355 missense probably damaging 1.00
R1908:St5 UTSW 7 109525326 nonsense probably null
R1909:St5 UTSW 7 109525326 nonsense probably null
R2232:St5 UTSW 7 109557207 missense probably benign
R2358:St5 UTSW 7 109556446 missense probably benign 0.01
R2847:St5 UTSW 7 109525337 missense probably damaging 1.00
R2869:St5 UTSW 7 109557430 missense probably benign 0.01
R2869:St5 UTSW 7 109557430 missense probably benign 0.01
R2870:St5 UTSW 7 109557430 missense probably benign 0.01
R2870:St5 UTSW 7 109557430 missense probably benign 0.01
R2871:St5 UTSW 7 109557430 missense probably benign 0.01
R2871:St5 UTSW 7 109557430 missense probably benign 0.01
R2873:St5 UTSW 7 109557430 missense probably benign 0.01
R2874:St5 UTSW 7 109557430 missense probably benign 0.01
R4534:St5 UTSW 7 109531156 missense probably damaging 1.00
R4536:St5 UTSW 7 109531156 missense probably damaging 1.00
R4559:St5 UTSW 7 109525578 missense probably damaging 1.00
R4798:St5 UTSW 7 109557033 missense probably damaging 0.99
R4846:St5 UTSW 7 109556836 nonsense probably null
R5110:St5 UTSW 7 109542490 missense probably benign 0.02
R5181:St5 UTSW 7 109556790 missense probably benign
R5268:St5 UTSW 7 109557312 missense probably benign
R5403:St5 UTSW 7 109556905 missense probably damaging 1.00
R5836:St5 UTSW 7 109541345 missense possibly damaging 0.78
R5932:St5 UTSW 7 109570016 missense probably damaging 1.00
R5937:St5 UTSW 7 109557271 missense possibly damaging 0.86
R6180:St5 UTSW 7 109556888 missense probably benign 0.11
R6741:St5 UTSW 7 109545097 missense possibly damaging 0.95
R6781:St5 UTSW 7 109525304 missense possibly damaging 0.83
R7086:St5 UTSW 7 109525574 missense probably damaging 1.00
R7466:St5 UTSW 7 109525346 missense probably damaging 1.00
R7644:St5 UTSW 7 109556793 nonsense probably null
X0067:St5 UTSW 7 109556240 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTCCACAGGTCTGCTAACC -3'
(R):5'- AGAGTAGCCAGCAGACACTG -3'

Sequencing Primer
(F):5'- GTCATATTTACCGTGACAATGCACAC -3'
(R):5'- CACTGTGTGTGCAGCCTG -3'
Posted On2019-06-07