Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4466001:St5'

555786

Institutional Source

Beutler Lab

Gene Symbol

St5

Ensembl Gene

ENSMUSG00000031024

Gene Name

suppression of tumorigenicity 5

Synonyms

2610305K15Rik, 2010004M01Rik

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.430) question?

Stock #

PIT4466001 (G1)

Quality Score

221.999

Status

Not validated

Chromosome

Chromosomal Location

109523911-109703605 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 109531130 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 888 (A888V)

Ref Sequence

ENSEMBL: ENSMUSP00000077067 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077909] [ENSMUST00000079282] [ENSMUST00000084738] [ENSMUST00000168005]

AlphaFold

Q924W7

Predicted Effect

probably damaging
Transcript: ENSMUST00000077909
AA Change: A888V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000077067
Gene: ENSMUSG00000031024
AA Change: A888V

Domain	Start	End	E-Value	Type
low complexity region	28	46	N/A	INTRINSIC
low complexity region	197	213	N/A	INTRINSIC
low complexity region	314	326	N/A	INTRINSIC
low complexity region	327	348	N/A	INTRINSIC
low complexity region	365	379	N/A	INTRINSIC
low complexity region	407	426	N/A	INTRINSIC
low complexity region	577	609	N/A	INTRINSIC
low complexity region	624	638	N/A	INTRINSIC
low complexity region	645	656	N/A	INTRINSIC
uDENN	690	781	1.16e-30	SMART
DENN	788	972	7.84e-78	SMART
low complexity region	1007	1014	N/A	INTRINSIC
dDENN	1019	1086	3.12e-22	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000079282
AA Change: A888V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000078264
Gene: ENSMUSG00000031024
AA Change: A888V

Domain	Start	End	E-Value	Type
low complexity region	28	46	N/A	INTRINSIC
low complexity region	197	213	N/A	INTRINSIC
low complexity region	314	326	N/A	INTRINSIC
low complexity region	327	348	N/A	INTRINSIC
low complexity region	365	379	N/A	INTRINSIC
low complexity region	407	426	N/A	INTRINSIC
low complexity region	577	609	N/A	INTRINSIC
low complexity region	624	638	N/A	INTRINSIC
low complexity region	645	656	N/A	INTRINSIC
uDENN	690	781	1.16e-30	SMART
DENN	788	972	7.84e-78	SMART
low complexity region	1007	1014	N/A	INTRINSIC
dDENN	1019	1086	3.12e-22	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000084738
AA Change: A471V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000081789
Gene: ENSMUSG00000031024
AA Change: A471V

Domain	Start	End	E-Value	Type
low complexity region	160	192	N/A	INTRINSIC
low complexity region	207	221	N/A	INTRINSIC
low complexity region	228	239	N/A	INTRINSIC
uDENN	273	364	1.16e-30	SMART
DENN	371	555	7.84e-78	SMART
low complexity region	590	597	N/A	INTRINSIC
dDENN	602	669	3.12e-22	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000168005
AA Change: A471V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000130119
Gene: ENSMUSG00000031024
AA Change: A471V

Domain	Start	End	E-Value	Type
low complexity region	160	192	N/A	INTRINSIC
low complexity region	207	221	N/A	INTRINSIC
low complexity region	228	239	N/A	INTRINSIC
uDENN	273	364	1.16e-30	SMART
DENN	371	555	7.84e-78	SMART
low complexity region	590	597	N/A	INTRINSIC
dDENN	602	669	3.12e-22	SMART

Coding Region Coverage

1x: 93.5%
3x: 90.9%
10x: 85.1%
20x: 72.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its ability to suppress the tumorigenicity of Hela cells in nude mice. The protein encoded by this gene contains a C-terminal region that shares similarity with the Rab 3 family of small GTP binding proteins. This protein preferentially binds to the SH3 domain of c-Abl kinase, and acts as a regulator of MAPK1/ERK2 kinase, which may contribute to its ability to reduce the tumorigenic phenotype in cells. Three alternatively spliced transcript variants of this gene encoding distinct isoforms are identified. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A4gnt	C	A	9: 99,620,560	P258T	probably damaging	Het
Adamts1	C	A	16: 85,796,691	G719*	probably null	Het
Ano5	G	T	7: 51,544,851	D111Y	probably damaging	Het
Arvcf	T	C	16: 18,402,949	V714A	possibly damaging	Het
AU021092	T	A	16: 5,220,389	S85C	probably damaging	Het
C87414	A	C	5: 93,636,288	L439R	probably damaging	Het
Capn5	T	C	7: 98,123,988	D603G	probably benign	Het
Cbr1	T	A	16: 93,609,804	V136E	probably damaging	Het
Ccdc27	T	C	4: 154,041,727	M102V	unknown	Het
Ccr1	T	C	9: 123,963,728	Y255C	probably damaging	Het
Cdr1	AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC	AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC	X: 61,184,524		probably benign	Het
Cep112	A	G	11: 108,519,896	T553A	probably benign	Het
Chd7	C	T	4: 8,753,101	L533F	unknown	Het
Cntnap1	T	C	11: 101,177,305	F48L	probably benign	Het
Cyb5r3	T	C	15: 83,161,863	D84G	probably damaging	Het
Ddx47	T	C	6: 135,015,840	I154T	probably benign	Het
Dnah6	A	G	6: 73,208,641	L99P	probably benign	Het
Dzank1	A	G	2: 144,483,373	I558T	probably benign	Het
Fbn1	T	C	2: 125,306,501	D2609G	possibly damaging	Het
Fhl5	C	A	4: 25,211,194	C166F	probably damaging	Het
Fndc1	A	G	17: 7,750,374	L1553P	probably damaging	Het
Frem1	G	A	4: 82,972,137	T1035I	probably benign	Het
Gm3099	A	G	14: 4,000,549	M128V	probably benign	Het
Gpaa1	C	T	15: 76,334,740	T594I	probably benign	Het
Hck	C	T	2: 153,124,271	T55M	probably damaging	Het
Hectd4	T	C	5: 121,333,060		probably null	Het
Ica1l	C	T	1: 60,015,836		probably null	Het
Ilf3	T	C	9: 21,403,366	Y765H	unknown	Het
Mast4	G	A	13: 102,804,718	T277M	probably damaging	Het
Mfsd6	T	C	1: 52,708,897	T270A	probably benign	Het
Mib1	G	A	18: 10,775,541	D498N	probably benign	Het
Naaladl1	A	T	19: 6,114,633	T576S	possibly damaging	Het
Ncoa6	A	T	2: 155,405,657	I1909N	probably benign	Het
Negr1	A	G	3: 156,859,598	D107G	probably benign	Het
Nlrc4	A	G	17: 74,427,119	M933T	probably benign	Het
Nmnat3	T	G	9: 98,410,253	F184V	probably benign	Het
Olfr1271	A	T	2: 90,266,295	V45E	probably damaging	Het
Olfr510	T	C	7: 108,667,536	V40A	possibly damaging	Het
Olfr8	C	A	10: 78,955,842	F212L	probably benign	Het
Olfr809	C	T	10: 129,776,273	R120C	probably benign	Het
Pfkfb4	T	C	9: 108,999,154	Y86H	probably benign	Het
Pgm5	T	G	19: 24,824,329	Q178H	probably damaging	Het
Phrf1	C	T	7: 141,258,812	T640M	unknown	Het
Psg18	T	G	7: 18,349,316	T305P	probably benign	Het
Skil	T	A	3: 31,098,232	V301D	probably damaging	Het
Slc36a1	C	A	11: 55,219,069	P68T	probably damaging	Het
Smim6	T	C	11: 115,913,545	F53L	probably benign	Het
Tpgs2	G	A	18: 25,168,595	T5M	possibly damaging	Het
Trrap	T	A	5: 144,828,600	V2523D	probably benign	Het
Usp9y	A	T	Y: 1,432,197	D429E	probably damaging	Het
Vmn1r125	A	G	7: 21,272,893	T239A	probably benign	Het
Vmn1r168	T	C	7: 23,540,996	F93L	probably damaging	Het
Vmn1r88	A	G	7: 13,178,476	N253S	possibly damaging	Het
Zfp644	C	T	5: 106,636,477	A735T	probably damaging	Het

Other mutations in St5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00493:St5	APN	7	109527708	missense	possibly damaging	0.71
IGL01132:St5	APN	7	109570005	splice site	probably null
IGL01288:St5	APN	7	109539822	missense	probably damaging	0.96
IGL01645:St5	APN	7	109527634	nonsense	probably null
IGL01714:St5	APN	7	109570062	missense	probably damaging	0.99
IGL02021:St5	APN	7	109557372	missense	probably damaging	1.00
IGL02302:St5	APN	7	109525331	missense	probably damaging	1.00
IGL02496:St5	APN	7	109556235	missense	possibly damaging	0.83
IGL02795:St5	APN	7	109556364	missense	probably damaging	1.00
Bucolic	UTSW	7	109525548	nonsense	probably null
Halcyon	UTSW	7	109556793	nonsense	probably null
FR4340:St5	UTSW	7	109556921	unclassified	probably benign
FR4737:St5	UTSW	7	109556921	unclassified	probably benign
PIT4469001:St5	UTSW	7	109531130	missense	probably damaging	1.00
PIT4472001:St5	UTSW	7	109531130	missense	probably damaging	1.00
R0024:St5	UTSW	7	109524659	missense	probably damaging	1.00
R0124:St5	UTSW	7	109542511	missense	possibly damaging	0.66
R0125:St5	UTSW	7	109556338	missense	probably benign	0.19
R0365:St5	UTSW	7	109538949	missense	probably damaging	1.00
R0491:St5	UTSW	7	109557204	missense	probably benign	0.45
R0534:St5	UTSW	7	109541428	missense	probably damaging	1.00
R0662:St5	UTSW	7	109557426	missense	probably damaging	1.00
R0743:St5	UTSW	7	109557345	missense	probably damaging	1.00
R0772:St5	UTSW	7	109542320	splice site	probably null
R0774:St5	UTSW	7	109542320	splice site	probably null
R0787:St5	UTSW	7	109525620	missense	possibly damaging	0.94
R0884:St5	UTSW	7	109557345	missense	probably damaging	1.00
R1518:St5	UTSW	7	109557355	missense	probably damaging	1.00
R1908:St5	UTSW	7	109525326	nonsense	probably null
R1909:St5	UTSW	7	109525326	nonsense	probably null
R2232:St5	UTSW	7	109557207	missense	probably benign
R2358:St5	UTSW	7	109556446	missense	probably benign	0.01
R2847:St5	UTSW	7	109525337	missense	probably damaging	1.00
R2869:St5	UTSW	7	109557430	missense	probably benign	0.01
R2869:St5	UTSW	7	109557430	missense	probably benign	0.01
R2870:St5	UTSW	7	109557430	missense	probably benign	0.01
R2870:St5	UTSW	7	109557430	missense	probably benign	0.01
R2871:St5	UTSW	7	109557430	missense	probably benign	0.01
R2871:St5	UTSW	7	109557430	missense	probably benign	0.01
R2873:St5	UTSW	7	109557430	missense	probably benign	0.01
R2874:St5	UTSW	7	109557430	missense	probably benign	0.01
R4534:St5	UTSW	7	109531156	missense	probably damaging	1.00
R4536:St5	UTSW	7	109531156	missense	probably damaging	1.00
R4559:St5	UTSW	7	109525578	missense	probably damaging	1.00
R4798:St5	UTSW	7	109557033	missense	probably damaging	0.99
R4846:St5	UTSW	7	109556836	nonsense	probably null
R5110:St5	UTSW	7	109542490	missense	probably benign	0.02
R5181:St5	UTSW	7	109556790	missense	probably benign
R5268:St5	UTSW	7	109557312	missense	probably benign
R5403:St5	UTSW	7	109556905	missense	probably damaging	1.00
R5836:St5	UTSW	7	109541345	missense	possibly damaging	0.78
R5932:St5	UTSW	7	109570016	missense	probably damaging	1.00
R5937:St5	UTSW	7	109557271	missense	possibly damaging	0.86
R6180:St5	UTSW	7	109556888	missense	probably benign	0.11
R6741:St5	UTSW	7	109545097	missense	possibly damaging	0.95
R6781:St5	UTSW	7	109525304	missense	possibly damaging	0.83
R7086:St5	UTSW	7	109525574	missense	probably damaging	1.00
R7466:St5	UTSW	7	109525346	missense	probably damaging	1.00
R7644:St5	UTSW	7	109556793	nonsense	probably null
R8354:St5	UTSW	7	109525548	nonsense	probably null
R8745:St5	UTSW	7	109557072	missense	probably benign	0.02
R8859:St5	UTSW	7	109524656	missense	probably damaging	1.00
R9016:St5	UTSW	7	109540435	missense	possibly damaging	0.84
R9178:St5	UTSW	7	109557084	missense	probably benign	0.31
R9361:St5	UTSW	7	109527784	missense	probably damaging	1.00
R9564:St5	UTSW	7	109526329	missense	probably damaging	1.00
R9595:St5	UTSW	7	109556766	missense	probably damaging	0.96
RF062:St5	UTSW	7	109556946	unclassified	probably benign
X0067:St5	UTSW	7	109556240	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTTCCACAGGTCTGCTAACC -3'
(R):5'- AGAGTAGCCAGCAGACACTG -3'

Sequencing Primer
(F):5'- GTCATATTTACCGTGACAATGCACAC -3'
(R):5'- CACTGTGTGTGCAGCCTG -3'

Posted On

2019-06-07