Incidental Mutation 'R0604:Olfr50'
ID55579
Institutional Source Beutler Lab
Gene Symbol Olfr50
Ensembl Gene ENSMUSG00000111021
Gene Nameolfactory receptor 50
SynonymsGA_x6K02T2NLDC-33487752-33488690, ID3, MOR136-6
MMRRC Submission 038793-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.369) question?
Stock #R0604 (G1)
Quality Score184
Status Not validated
Chromosome2
Chromosomal Location36790538-36797392 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 36794107 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 290 (Y290*)
Ref Sequence ENSEMBL: ENSMUSP00000149484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072114] [ENSMUST00000112950] [ENSMUST00000213498] [ENSMUST00000214909] [ENSMUST00000215199] [ENSMUST00000216753] [ENSMUST00000217041]
Predicted Effect probably null
Transcript: ENSMUST00000072114
AA Change: Y290*
SMART Domains Protein: ENSMUSP00000071985
Gene: ENSMUSG00000068950
AA Change: Y290*

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.3e-57 PFAM
Pfam:7TM_GPCR_Srsx 35 305 3.8e-8 PFAM
Pfam:7tm_1 41 290 1.1e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000112950
AA Change: Y290*
SMART Domains Protein: ENSMUSP00000108572
Gene: ENSMUSG00000111021
AA Change: Y290*

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 36 306 3e-6 PFAM
Pfam:7tm_1 42 291 3.5e-34 PFAM
Pfam:7tm_4 140 284 3.9e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213498
Predicted Effect probably benign
Transcript: ENSMUST00000214909
Predicted Effect probably benign
Transcript: ENSMUST00000215199
Predicted Effect probably null
Transcript: ENSMUST00000216753
AA Change: Y290*
Predicted Effect probably null
Transcript: ENSMUST00000217041
AA Change: Y290*
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik C A 2: 28,466,091 R60L possibly damaging Het
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Acap1 T C 11: 69,884,625 E302G probably benign Het
Adrb2 G A 18: 62,178,515 T413I possibly damaging Het
Aqr T C 2: 114,130,604 K725R probably benign Het
Braf A G 6: 39,623,697 I662T probably damaging Het
Ccdc178 A G 18: 22,067,443 S435P probably benign Het
Chd9 A G 8: 91,036,542 M2332V possibly damaging Het
Clgn T C 8: 83,424,194 V496A probably benign Het
Dnah17 A C 11: 118,121,471 S193R probably benign Het
Dntt A G 19: 41,053,149 E424G probably benign Het
Fam149a A G 8: 45,345,008 L492P probably damaging Het
Fetub T C 16: 22,935,660 Y126H possibly damaging Het
Fgfr3 A T 5: 33,732,782 Y96F probably damaging Het
Gm4952 A G 19: 12,624,672 E148G probably benign Het
Gucy2g T A 19: 55,203,087 L977F probably benign Het
Il1r1 T C 1: 40,282,246 V6A probably benign Het
Itsn2 C A 12: 4,658,189 Q832K probably benign Het
Lats1 T A 10: 7,712,661 F1014Y probably damaging Het
Mcc G A 18: 44,473,756 A536V probably damaging Het
Mtrf1 T C 14: 79,415,887 V334A possibly damaging Het
Olfr1179 T C 2: 88,402,383 T184A probably benign Het
Olfr325 T A 11: 58,581,348 M168K probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Pard6g A G 18: 80,117,208 S179G probably damaging Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Psg27 A T 7: 18,557,072 V402D probably damaging Het
Rttn A G 18: 88,977,758 I222V probably damaging Het
Sp9 T A 2: 73,273,638 S179T probably benign Het
Tbc1d8 T A 1: 39,405,326 H184L probably damaging Het
Vmn1r69 A G 7: 10,580,654 V50A probably benign Het
Vmn2r58 A G 7: 41,860,576 F526L possibly damaging Het
Other mutations in Olfr50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Olfr50 APN 2 36794000 missense probably benign 0.05
IGL02316:Olfr50 APN 2 36793620 missense probably damaging 0.98
IGL02330:Olfr50 APN 2 36793895 missense probably benign 0.00
IGL03144:Olfr50 APN 2 36794081 missense probably benign 0.44
R0092:Olfr50 UTSW 2 36793496 missense probably benign 0.06
R0113:Olfr50 UTSW 2 36793994 missense probably damaging 0.98
R0113:Olfr50 UTSW 2 36793995 missense probably damaging 0.99
R0932:Olfr50 UTSW 2 36793891 nonsense probably null
R1191:Olfr50 UTSW 2 36793338 missense probably damaging 0.97
R1238:Olfr50 UTSW 2 36793589 missense probably damaging 1.00
R1525:Olfr50 UTSW 2 36794143 missense probably null 0.01
R3103:Olfr50 UTSW 2 36793562 missense possibly damaging 0.80
R3955:Olfr50 UTSW 2 36793553 missense probably benign 0.34
R4573:Olfr50 UTSW 2 36793479 missense probably damaging 1.00
R5256:Olfr50 UTSW 2 36793673 missense probably benign
R5650:Olfr50 UTSW 2 36793265 missense probably benign 0.36
R6130:Olfr50 UTSW 2 36794043 missense probably benign 0.01
R6175:Olfr50 UTSW 2 36793968 missense probably damaging 1.00
R6320:Olfr50 UTSW 2 36793573 missense possibly damaging 0.90
R6481:Olfr50 UTSW 2 36793777 missense possibly damaging 0.63
R7164:Olfr50 UTSW 2 36793697 missense probably benign 0.34
R7622:Olfr50 UTSW 2 36793931 missense probably benign 0.06
R8391:Olfr50 UTSW 2 36794084 missense probably damaging 0.99
R8846:Olfr50 UTSW 2 36793677 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGGGCCACTATCCTAAGAACTCCA -3'
(R):5'- CAGGGCTGAGATGAAACAGGCTG -3'

Sequencing Primer
(F):5'- TCCATCAAGGGTATCTGCAAAG -3'
(R):5'- CTGAGATGAAACAGGCTGAAAAAATC -3'
Posted On2013-07-11