Incidental Mutation 'R0604:Sp9'
ID55580
Institutional Source Beutler Lab
Gene Symbol Sp9
Ensembl Gene ENSMUSG00000068859
Gene Nametrans-acting transcription factor 9
Synonyms
MMRRC Submission 038793-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.455) question?
Stock #R0604 (G1)
Quality Score153
Status Not validated
Chromosome2
Chromosomal Location73271925-73284706 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73273638 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 179 (S179T)
Ref Sequence ENSEMBL: ENSMUSP00000088322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090813]
Predicted Effect probably benign
Transcript: ENSMUST00000090813
AA Change: S179T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000088322
Gene: ENSMUSG00000068859
AA Change: S179T

DomainStartEndE-ValueType
low complexity region 53 65 N/A INTRINSIC
low complexity region 71 88 N/A INTRINSIC
low complexity region 92 103 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 268 306 N/A INTRINSIC
ZnF_C2H2 332 356 2.63e0 SMART
ZnF_C2H2 362 386 1.84e-4 SMART
ZnF_C2H2 392 414 5.99e-4 SMART
low complexity region 416 427 N/A INTRINSIC
low complexity region 452 472 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147133
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik C A 2: 28,466,091 R60L possibly damaging Het
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Acap1 T C 11: 69,884,625 E302G probably benign Het
Adrb2 G A 18: 62,178,515 T413I possibly damaging Het
Aqr T C 2: 114,130,604 K725R probably benign Het
Braf A G 6: 39,623,697 I662T probably damaging Het
Ccdc178 A G 18: 22,067,443 S435P probably benign Het
Chd9 A G 8: 91,036,542 M2332V possibly damaging Het
Clgn T C 8: 83,424,194 V496A probably benign Het
Dnah17 A C 11: 118,121,471 S193R probably benign Het
Dntt A G 19: 41,053,149 E424G probably benign Het
Fam149a A G 8: 45,345,008 L492P probably damaging Het
Fetub T C 16: 22,935,660 Y126H possibly damaging Het
Fgfr3 A T 5: 33,732,782 Y96F probably damaging Het
Gm4952 A G 19: 12,624,672 E148G probably benign Het
Gucy2g T A 19: 55,203,087 L977F probably benign Het
Il1r1 T C 1: 40,282,246 V6A probably benign Het
Itsn2 C A 12: 4,658,189 Q832K probably benign Het
Lats1 T A 10: 7,712,661 F1014Y probably damaging Het
Mcc G A 18: 44,473,756 A536V probably damaging Het
Mtrf1 T C 14: 79,415,887 V334A possibly damaging Het
Olfr1179 T C 2: 88,402,383 T184A probably benign Het
Olfr325 T A 11: 58,581,348 M168K probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr50 T A 2: 36,794,107 Y290* probably null Het
Pard6g A G 18: 80,117,208 S179G probably damaging Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Psg27 A T 7: 18,557,072 V402D probably damaging Het
Rttn A G 18: 88,977,758 I222V probably damaging Het
Tbc1d8 T A 1: 39,405,326 H184L probably damaging Het
Vmn1r69 A G 7: 10,580,654 V50A probably benign Het
Vmn2r58 A G 7: 41,860,576 F526L possibly damaging Het
Other mutations in Sp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03129:Sp9 APN 2 73273521 missense probably benign 0.00
R0718:Sp9 UTSW 2 73273827 missense possibly damaging 0.70
R3423:Sp9 UTSW 2 73273971 missense probably benign 0.00
R3747:Sp9 UTSW 2 73274308 missense probably damaging 0.98
R4335:Sp9 UTSW 2 73274289 missense probably damaging 1.00
R4873:Sp9 UTSW 2 73273618 missense possibly damaging 0.86
R4875:Sp9 UTSW 2 73273618 missense possibly damaging 0.86
R5341:Sp9 UTSW 2 73274514 missense possibly damaging 0.92
R5389:Sp9 UTSW 2 73274297 missense probably damaging 0.99
R5891:Sp9 UTSW 2 73274251 missense probably damaging 1.00
R6938:Sp9 UTSW 2 73273272 missense probably damaging 0.99
R7092:Sp9 UTSW 2 73273771 missense probably damaging 0.99
R7699:Sp9 UTSW 2 73273380 missense probably damaging 0.98
R8336:Sp9 UTSW 2 73274452 missense possibly damaging 0.86
R8809:Sp9 UTSW 2 73273675 missense probably damaging 1.00
Z1088:Sp9 UTSW 2 73273230 missense possibly damaging 0.94
Z1176:Sp9 UTSW 2 73273456 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCGCCTTCAGCAGCGACTATG -3'
(R):5'- TTGCCGTACACCTTGCCACAGC -3'

Sequencing Primer
(F):5'- TTCTCCAACTcggcggc -3'
(R):5'- gctgcgcccgAAATCATAG -3'
Posted On2013-07-11