Incidental Mutation 'PIT4469001:A630001G21Rik'
ID555815
Institutional Source Beutler Lab
Gene Symbol A630001G21Rik
Ensembl Gene ENSMUSG00000052760
Gene NameRIKEN cDNA A630001G21 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #PIT4469001 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location85717083-85778643 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85725199 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 83 (F83L)
Ref Sequence ENSEMBL: ENSMUSP00000124137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064788] [ENSMUST00000159122] [ENSMUST00000162038]
Predicted Effect probably benign
Transcript: ENSMUST00000064788
AA Change: F83L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000070374
Gene: ENSMUSG00000052760
AA Change: F83L

DomainStartEndE-ValueType
Pfam:Sp100 11 109 3.1e-40 PFAM
low complexity region 168 187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159122
AA Change: F83L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000124137
Gene: ENSMUSG00000052760
AA Change: F83L

DomainStartEndE-ValueType
Pfam:Sp100 9 112 8.3e-45 PFAM
low complexity region 168 187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162038
AA Change: F83L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125643
Gene: ENSMUSG00000052760
AA Change: F83L

DomainStartEndE-ValueType
Pfam:Sp100 11 109 4e-41 PFAM
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.7%
  • 10x: 84.4%
  • 20x: 71.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030408B16Rik T C 15: 101,293,271 V6A probably benign Het
Acsm2 T A 7: 119,578,185 C308S possibly damaging Het
Ak3 A G 19: 29,047,757 S25P probably damaging Het
Atp13a2 T A 4: 140,994,127 V176E unknown Het
Bmper A T 9: 23,406,549 H488L probably benign Het
Cacna1c A T 6: 118,595,972 C2084S unknown Het
Ccp110 T A 7: 118,722,377 N418K probably benign Het
Ddx17 C A 15: 79,543,813 G32C probably damaging Het
Dusp16 G A 6: 134,761,152 probably benign Het
Efl1 T G 7: 82,658,165 F90V probably benign Het
Ell2 T A 13: 75,761,892 N252K probably damaging Het
Gdf6 T C 4: 9,859,569 V217A probably damaging Het
Gm6205 T A 5: 94,682,793 V50E probably damaging Het
Hint1 T A 11: 54,870,070 S112T unknown Het
Hist1h1e A T 13: 23,622,379 V40E probably damaging Het
Kif5c T C 2: 49,741,348 V679A probably benign Het
Lrrn3 A T 12: 41,453,018 D433E probably benign Het
Mast4 G A 13: 102,804,718 T277M probably damaging Het
Naa11 A G 5: 97,391,626 probably null Het
Pcdh18 T A 3: 49,755,069 H599L probably benign Het
Pgc A T 17: 47,728,755 K25* probably null Het
Psd4 G A 2: 24,394,294 D57N probably benign Het
Pxdn G A 12: 30,005,829 R1238Q probably benign Het
Spata32 T C 11: 103,209,827 N38S probably benign Het
St5 G A 7: 109,531,130 A888V probably damaging Het
Tpr A G 1: 150,403,956 T279A probably benign Het
Unc13a C A 8: 71,658,314 E418* probably null Het
Vmn2r97 C A 17: 18,929,616 T422K probably benign Het
Zfp474 A T 18: 52,638,719 Q148L possibly damaging Het
Other mutations in A630001G21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02572:A630001G21Rik APN 1 85725171 missense probably damaging 0.96
FR4737:A630001G21Rik UTSW 1 85723135 utr 3 prime probably benign
R0423:A630001G21Rik UTSW 1 85726466 missense probably benign 0.03
R3029:A630001G21Rik UTSW 1 85718245 missense probably benign 0.33
R4417:A630001G21Rik UTSW 1 85726463 missense probably damaging 0.98
R4876:A630001G21Rik UTSW 1 85719040 missense probably damaging 0.98
R5592:A630001G21Rik UTSW 1 85726611 missense probably damaging 0.96
R5719:A630001G21Rik UTSW 1 85723385 missense probably benign 0.01
R5780:A630001G21Rik UTSW 1 85718318 missense probably benign 0.02
X0020:A630001G21Rik UTSW 1 85725259 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGCATTTATTTCAATCCCTCAC -3'
(R):5'- CAGAGAAACTAGAATCCACAGGC -3'

Sequencing Primer
(F):5'- ACCCTTAGCTGAGTTACTATTGGCAG -3'
(R):5'- GGCCCCCAGACAGTATTTC -3'
Posted On2019-06-07