Incidental Mutation 'PIT4469001:A630001G21Rik'
ID 555815
Institutional Source Beutler Lab
Gene Symbol A630001G21Rik
Ensembl Gene ENSMUSG00000052760
Gene Name RIKEN cDNA A630001G21 gene
Synonyms
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # PIT4469001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 85644804-85664377 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 85652920 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 83 (F83L)
Ref Sequence ENSEMBL: ENSMUSP00000124137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064788] [ENSMUST00000159122] [ENSMUST00000162038]
AlphaFold Q3UTB2
Predicted Effect probably benign
Transcript: ENSMUST00000064788
AA Change: F83L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000070374
Gene: ENSMUSG00000052760
AA Change: F83L

DomainStartEndE-ValueType
Pfam:Sp100 11 109 3.1e-40 PFAM
low complexity region 168 187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159122
AA Change: F83L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000124137
Gene: ENSMUSG00000052760
AA Change: F83L

DomainStartEndE-ValueType
Pfam:Sp100 9 112 8.3e-45 PFAM
low complexity region 168 187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162038
AA Change: F83L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125643
Gene: ENSMUSG00000052760
AA Change: F83L

DomainStartEndE-ValueType
Pfam:Sp100 11 109 4e-41 PFAM
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.7%
  • 10x: 84.4%
  • 20x: 71.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,177,408 (GRCm39) C308S possibly damaging Het
Ak3 A G 19: 29,025,157 (GRCm39) S25P probably damaging Het
Atp13a2 T A 4: 140,721,438 (GRCm39) V176E unknown Het
Bmper A T 9: 23,317,845 (GRCm39) H488L probably benign Het
Cacna1c A T 6: 118,572,933 (GRCm39) C2084S unknown Het
Ccp110 T A 7: 118,321,600 (GRCm39) N418K probably benign Het
Ddx17 C A 15: 79,428,014 (GRCm39) G32C probably damaging Het
Dennd2b G A 7: 109,130,337 (GRCm39) A888V probably damaging Het
Dusp16 G A 6: 134,738,115 (GRCm39) probably benign Het
Efl1 T G 7: 82,307,373 (GRCm39) F90V probably benign Het
Ell2 T A 13: 75,910,011 (GRCm39) N252K probably damaging Het
Gdf6 T C 4: 9,859,569 (GRCm39) V217A probably damaging Het
H1f4 A T 13: 23,806,362 (GRCm39) V40E probably damaging Het
Hint1 T A 11: 54,760,896 (GRCm39) S112T unknown Het
Kif5c T C 2: 49,631,360 (GRCm39) V679A probably benign Het
Lrrn3 A T 12: 41,503,017 (GRCm39) D433E probably benign Het
Mast4 G A 13: 102,941,226 (GRCm39) T277M probably damaging Het
Naa11 A G 5: 97,539,485 (GRCm39) probably null Het
Pcdh18 T A 3: 49,709,518 (GRCm39) H599L probably benign Het
Pgc A T 17: 48,039,680 (GRCm39) K25* probably null Het
Pramel58 T A 5: 94,830,652 (GRCm39) V50E probably damaging Het
Psd4 G A 2: 24,284,306 (GRCm39) D57N probably benign Het
Pxdn G A 12: 30,055,828 (GRCm39) R1238Q probably benign Het
Smim41 T C 15: 101,191,152 (GRCm39) V6A probably benign Het
Spata32 T C 11: 103,100,653 (GRCm39) N38S probably benign Het
Tpr A G 1: 150,279,707 (GRCm39) T279A probably benign Het
Unc13a C A 8: 72,110,958 (GRCm39) E418* probably null Het
Vmn2r97 C A 17: 19,149,878 (GRCm39) T422K probably benign Het
Zfp474 A T 18: 52,771,791 (GRCm39) Q148L possibly damaging Het
Other mutations in A630001G21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02572:A630001G21Rik APN 1 85,652,892 (GRCm39) missense probably damaging 0.96
FR4737:A630001G21Rik UTSW 1 85,650,856 (GRCm39) utr 3 prime probably benign
R0423:A630001G21Rik UTSW 1 85,654,187 (GRCm39) missense probably benign 0.03
R3029:A630001G21Rik UTSW 1 85,645,966 (GRCm39) missense probably benign 0.33
R4417:A630001G21Rik UTSW 1 85,654,184 (GRCm39) missense probably damaging 0.98
R4876:A630001G21Rik UTSW 1 85,646,761 (GRCm39) missense probably damaging 0.98
R5592:A630001G21Rik UTSW 1 85,654,332 (GRCm39) missense probably damaging 0.96
R5719:A630001G21Rik UTSW 1 85,651,106 (GRCm39) missense probably benign 0.01
R5780:A630001G21Rik UTSW 1 85,646,039 (GRCm39) missense probably benign 0.02
R9397:A630001G21Rik UTSW 1 85,653,002 (GRCm39) nonsense probably null
X0020:A630001G21Rik UTSW 1 85,652,980 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGCATTTATTTCAATCCCTCAC -3'
(R):5'- CAGAGAAACTAGAATCCACAGGC -3'

Sequencing Primer
(F):5'- ACCCTTAGCTGAGTTACTATTGGCAG -3'
(R):5'- GGCCCCCAGACAGTATTTC -3'
Posted On 2019-06-07