Incidental Mutation 'PIT4469001:Pcdh18'
ID555819
Institutional Source Beutler Lab
Gene Symbol Pcdh18
Ensembl Gene ENSMUSG00000037892
Gene Nameprotocadherin 18
SynonymsPCDH68L
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4469001 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location49743296-49757325 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49755069 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 599 (H599L)
Ref Sequence ENSEMBL: ENSMUSP00000039245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035931] [ENSMUST00000191794]
Predicted Effect probably benign
Transcript: ENSMUST00000035931
AA Change: H599L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039245
Gene: ENSMUSG00000037892
AA Change: H599L

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
CA 51 135 1.36e-1 SMART
CA 159 244 3.78e-20 SMART
CA 268 352 1.12e-22 SMART
CA 382 463 5.76e-25 SMART
CA 487 574 2.51e-25 SMART
CA 603 684 8e-3 SMART
transmembrane domain 698 720 N/A INTRINSIC
low complexity region 772 783 N/A INTRINSIC
low complexity region 988 1009 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191794
AA Change: H599L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141995
Gene: ENSMUSG00000037892
AA Change: H599L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 51 135 6.6e-4 SMART
CA 159 244 1.9e-22 SMART
CA 268 352 5.6e-25 SMART
CA 382 463 2.7e-27 SMART
CA 487 574 1.2e-27 SMART
CA 603 684 3.9e-5 SMART
transmembrane domain 698 720 N/A INTRINSIC
low complexity region 772 783 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.7%
  • 10x: 84.4%
  • 20x: 71.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. This gene encodes a protein which contains 6 extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from those of the classical cadherins. Although its specific function is undetermined, the cadherin-related neuronal receptor is thought to play a role in the establishment and function of specific cell-cell connections in the brain. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030408B16Rik T C 15: 101,293,271 V6A probably benign Het
A630001G21Rik A G 1: 85,725,199 F83L probably benign Het
Acsm2 T A 7: 119,578,185 C308S possibly damaging Het
Ak3 A G 19: 29,047,757 S25P probably damaging Het
Atp13a2 T A 4: 140,994,127 V176E unknown Het
Bmper A T 9: 23,406,549 H488L probably benign Het
Cacna1c A T 6: 118,595,972 C2084S unknown Het
Ccp110 T A 7: 118,722,377 N418K probably benign Het
Ddx17 C A 15: 79,543,813 G32C probably damaging Het
Dusp16 G A 6: 134,761,152 probably benign Het
Efl1 T G 7: 82,658,165 F90V probably benign Het
Ell2 T A 13: 75,761,892 N252K probably damaging Het
Gdf6 T C 4: 9,859,569 V217A probably damaging Het
Gm6205 T A 5: 94,682,793 V50E probably damaging Het
Hint1 T A 11: 54,870,070 S112T unknown Het
Hist1h1e A T 13: 23,622,379 V40E probably damaging Het
Kif5c T C 2: 49,741,348 V679A probably benign Het
Lrrn3 A T 12: 41,453,018 D433E probably benign Het
Mast4 G A 13: 102,804,718 T277M probably damaging Het
Naa11 A G 5: 97,391,626 probably null Het
Pgc A T 17: 47,728,755 K25* probably null Het
Psd4 G A 2: 24,394,294 D57N probably benign Het
Pxdn G A 12: 30,005,829 R1238Q probably benign Het
Spata32 T C 11: 103,209,827 N38S probably benign Het
St5 G A 7: 109,531,130 A888V probably damaging Het
Tpr A G 1: 150,403,956 T279A probably benign Het
Unc13a C A 8: 71,658,314 E418* probably null Het
Vmn2r97 C A 17: 18,929,616 T422K probably benign Het
Zfp474 A T 18: 52,638,719 Q148L possibly damaging Het
Other mutations in Pcdh18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Pcdh18 APN 3 49753379 missense probably damaging 1.00
IGL00639:Pcdh18 APN 3 49755616 missense probably benign 0.34
IGL00954:Pcdh18 APN 3 49756389 missense probably damaging 1.00
IGL01338:Pcdh18 APN 3 49756141 missense probably damaging 1.00
IGL01339:Pcdh18 APN 3 49755798 missense probably benign 0.35
IGL01687:Pcdh18 APN 3 49753533 splice site probably benign
IGL01727:Pcdh18 APN 3 49755700 missense probably damaging 0.99
IGL01788:Pcdh18 APN 3 49755922 nonsense probably null
IGL01824:Pcdh18 APN 3 49754774 missense probably damaging 1.00
IGL01834:Pcdh18 APN 3 49756830 missense probably benign 0.03
IGL01913:Pcdh18 APN 3 49755249 missense possibly damaging 0.94
IGL01915:Pcdh18 APN 3 49744921 missense probably benign
IGL02095:Pcdh18 APN 3 49756156 missense probably benign 0.01
IGL02128:Pcdh18 APN 3 49756686 missense possibly damaging 0.65
IGL02302:Pcdh18 APN 3 49755938 missense probably benign
IGL02342:Pcdh18 APN 3 49756044 missense probably damaging 1.00
IGL02440:Pcdh18 APN 3 49744603 utr 3 prime probably benign
IGL02499:Pcdh18 APN 3 49753447 missense probably benign 0.15
IGL02570:Pcdh18 APN 3 49756625 missense probably benign 0.02
IGL02745:Pcdh18 APN 3 49755891 missense probably damaging 1.00
IGL03073:Pcdh18 APN 3 49753367 missense possibly damaging 0.93
R0078:Pcdh18 UTSW 3 49756344 missense probably damaging 1.00
R0196:Pcdh18 UTSW 3 49756698 splice site probably null
R0524:Pcdh18 UTSW 3 49755642 missense probably damaging 0.98
R0661:Pcdh18 UTSW 3 49753318 missense possibly damaging 0.64
R0900:Pcdh18 UTSW 3 49756803 missense probably benign 0.25
R1101:Pcdh18 UTSW 3 49753379 missense probably damaging 1.00
R1463:Pcdh18 UTSW 3 49755405 missense probably damaging 0.99
R1778:Pcdh18 UTSW 3 49755634 missense probably benign 0.19
R1850:Pcdh18 UTSW 3 49756405 missense probably benign 0.22
R1875:Pcdh18 UTSW 3 49754705 missense probably damaging 0.99
R1903:Pcdh18 UTSW 3 49755447 missense probably benign
R1956:Pcdh18 UTSW 3 49755951 missense probably benign
R2044:Pcdh18 UTSW 3 49754940 missense probably benign
R2303:Pcdh18 UTSW 3 49755274 missense probably damaging 1.00
R3732:Pcdh18 UTSW 3 49754791 missense probably benign
R3732:Pcdh18 UTSW 3 49754791 missense probably benign
R3733:Pcdh18 UTSW 3 49754791 missense probably benign
R3973:Pcdh18 UTSW 3 49754586 missense probably damaging 1.00
R4281:Pcdh18 UTSW 3 49756533 missense possibly damaging 0.76
R4601:Pcdh18 UTSW 3 49744725 missense probably damaging 1.00
R4631:Pcdh18 UTSW 3 49756441 missense probably damaging 0.99
R4752:Pcdh18 UTSW 3 49755114 missense probably damaging 1.00
R4840:Pcdh18 UTSW 3 49744668 missense probably damaging 0.98
R4867:Pcdh18 UTSW 3 49754664 missense probably damaging 1.00
R5007:Pcdh18 UTSW 3 49754457 missense probably benign 0.23
R5039:Pcdh18 UTSW 3 49754856 missense probably benign
R5169:Pcdh18 UTSW 3 49755966 missense possibly damaging 0.65
R5438:Pcdh18 UTSW 3 49756016 nonsense probably null
R5579:Pcdh18 UTSW 3 49744977 missense probably damaging 1.00
R6000:Pcdh18 UTSW 3 49754464 missense probably damaging 0.99
R6220:Pcdh18 UTSW 3 49745251 missense probably damaging 1.00
R6737:Pcdh18 UTSW 3 49755895 missense probably damaging 0.98
R6789:Pcdh18 UTSW 3 49755915 missense probably benign 0.00
R7011:Pcdh18 UTSW 3 49754782 missense probably benign
R7146:Pcdh18 UTSW 3 49755822 missense probably damaging 1.00
R7150:Pcdh18 UTSW 3 49754694 missense probably benign 0.31
R7205:Pcdh18 UTSW 3 49755474 missense probably benign
R7326:Pcdh18 UTSW 3 49756860 missense probably benign
R7413:Pcdh18 UTSW 3 49744783 missense possibly damaging 0.94
R7755:Pcdh18 UTSW 3 49754829 missense possibly damaging 0.59
R7848:Pcdh18 UTSW 3 49755997 missense possibly damaging 0.54
R8169:Pcdh18 UTSW 3 49745235 missense probably damaging 1.00
R8264:Pcdh18 UTSW 3 49756581 missense probably damaging 1.00
R8352:Pcdh18 UTSW 3 49745175 missense possibly damaging 0.81
R8406:Pcdh18 UTSW 3 49756549 missense probably damaging 1.00
R8452:Pcdh18 UTSW 3 49745175 missense possibly damaging 0.81
R8489:Pcdh18 UTSW 3 49754589 missense probably damaging 1.00
R8526:Pcdh18 UTSW 3 49755574 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATGCACCTCAGAAGGACTTTG -3'
(R):5'- ACTTTTGTGGTGGAAGCCAG -3'

Sequencing Primer
(F):5'- CCCTTGTCCTGGATGATAACTGAGAG -3'
(R):5'- TGTGGTGGAAGCCAGGGATG -3'
Posted On2019-06-07