Mutagenetix > Incidental Mutations

Incidental Mutation 'PIT4469001:Atp13a2'

555821

Institutional Source

Beutler Lab

Gene Symbol

Atp13a2

Ensembl Gene

ENSMUSG00000036622

Gene Name

ATPase type 13A2

Synonyms

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

PIT4469001 (G1)

Quality Score

123.008

Status

Not validated

Chromosome

Chromosomal Location

140986873-141007330 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 140994127 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 176 (V176E)

Ref Sequence

ENSEMBL: ENSMUSP00000126461 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037055] [ENSMUST00000127833] [ENSMUST00000168047]

Predicted Effect

probably benign
Transcript: ENSMUST00000037055

SMART Domains

Protein: ENSMUSP00000039648
Gene: ENSMUSG00000036622

Domain	Start	End	E-Value	Type
Pfam:P5-ATPase	31	171	8.9e-27	PFAM
Cation_ATPase_N	179	251	9.78e-1	SMART
Pfam:E1-E2_ATPase	256	497	3.6e-39	PFAM
Pfam:Hydrolase	502	785	2e-14	PFAM
Pfam:HAD	505	876	3.6e-27	PFAM
transmembrane domain	920	942	N/A	INTRINSIC
transmembrane domain	957	979	N/A	INTRINSIC
transmembrane domain	991	1013	N/A	INTRINSIC
transmembrane domain	1033	1055	N/A	INTRINSIC
transmembrane domain	1068	1090	N/A	INTRINSIC
transmembrane domain	1105	1127	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000127833

SMART Domains

Protein: ENSMUSP00000132183
Gene: ENSMUSG00000036622

Domain	Start	End	E-Value	Type
Pfam:P5-ATPase	31	164	7.4e-29	PFAM
Cation_ATPase_N	179	251	9.78e-1	SMART
Pfam:E1-E2_ATPase	256	496	6e-34	PFAM
Pfam:HAD	505	876	4e-27	PFAM
Pfam:Hydrolase	663	879	2.5e-15	PFAM
transmembrane domain	925	947	N/A	INTRINSIC
transmembrane domain	954	976	N/A	INTRINSIC
transmembrane domain	991	1013	N/A	INTRINSIC
low complexity region	1102	1115	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000168047
AA Change: V176E

SMART Domains

Protein: ENSMUSP00000126461
Gene: ENSMUSG00000036622
AA Change: V176E

Domain	Start	End	E-Value	Type
Pfam:P5-ATPase	31	156	1e-27	PFAM
Cation_ATPase_N	262	334	9.78e-1	SMART
Pfam:E1-E2_ATPase	339	579	4.8e-34	PFAM
Pfam:HAD	588	959	3e-27	PFAM
Pfam:Hydrolase	726	962	1.8e-15	PFAM

Coding Region Coverage

1x: 93.3%
3x: 90.7%
10x: 84.4%
20x: 71.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the P5 subfamily of ATPases which transports inorganic cations as well as other substrates. Mutations in this gene are associated with Kufor-Rakeb syndrome (KRS), also referred to as Parkinson disease 9. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neuronal ceroid lipofuscinosis, synuclein accumulation and age-dependent sensorimotor deficits. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6030408B16Rik	T	C	15: 101,293,271	V6A	probably benign	Het
A630001G21Rik	A	G	1: 85,725,199	F83L	probably benign	Het
Acsm2	T	A	7: 119,578,185	C308S	possibly damaging	Het
Ak3	A	G	19: 29,047,757	S25P	probably damaging	Het
Bmper	A	T	9: 23,406,549	H488L	probably benign	Het
Cacna1c	A	T	6: 118,595,972	C2084S	unknown	Het
Ccp110	T	A	7: 118,722,377	N418K	probably benign	Het
Ddx17	C	A	15: 79,543,813	G32C	probably damaging	Het
Dusp16	G	A	6: 134,761,152		probably benign	Het
Efl1	T	G	7: 82,658,165	F90V	probably benign	Het
Ell2	T	A	13: 75,761,892	N252K	probably damaging	Het
Gdf6	T	C	4: 9,859,569	V217A	probably damaging	Het
Gm6205	T	A	5: 94,682,793	V50E	probably damaging	Het
Hint1	T	A	11: 54,870,070	S112T	unknown	Het
Hist1h1e	A	T	13: 23,622,379	V40E	probably damaging	Het
Kif5c	T	C	2: 49,741,348	V679A	probably benign	Het
Lrrn3	A	T	12: 41,453,018	D433E	probably benign	Het
Mast4	G	A	13: 102,804,718	T277M	probably damaging	Het
Naa11	A	G	5: 97,391,626		probably null	Het
Pcdh18	T	A	3: 49,755,069	H599L	probably benign	Het
Pgc	A	T	17: 47,728,755	K25*	probably null	Het
Psd4	G	A	2: 24,394,294	D57N	probably benign	Het
Pxdn	G	A	12: 30,005,829	R1238Q	probably benign	Het
Spata32	T	C	11: 103,209,827	N38S	probably benign	Het
St5	G	A	7: 109,531,130	A888V	probably damaging	Het
Tpr	A	G	1: 150,403,956	T279A	probably benign	Het
Unc13a	C	A	8: 71,658,314	E418*	probably null	Het
Vmn2r97	C	A	17: 18,929,616	T422K	probably benign	Het
Zfp474	A	T	18: 52,638,719	Q148L	possibly damaging	Het

Other mutations in Atp13a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01410:Atp13a2	APN	4	140992198	missense	probably benign	0.02
IGL01476:Atp13a2	APN	4	141000770	missense	probably damaging	1.00
IGL01980:Atp13a2	APN	4	141006152	missense	probably benign	0.00
IGL02257:Atp13a2	APN	4	141006089	missense	probably benign	0.00
IGL02589:Atp13a2	APN	4	141006411	missense	probably damaging	1.00
IGL02936:Atp13a2	APN	4	141001949	missense	probably benign	0.00
IGL03032:Atp13a2	APN	4	141000355	missense	possibly damaging	0.95
IGL03040:Atp13a2	APN	4	141006173	missense	probably damaging	1.00
IGL03271:Atp13a2	APN	4	141000397	missense	possibly damaging	0.69
calla	UTSW	4	140994332	nonsense	probably null
eastern_moon	UTSW	4	141005016	missense	probably damaging	0.99
yucca_brevifolia	UTSW	4	140993802	missense	probably damaging	1.00
IGL03054:Atp13a2	UTSW	4	141006968	missense	possibly damaging	0.83
R0634:Atp13a2	UTSW	4	141006929	unclassified	probably benign
R0881:Atp13a2	UTSW	4	141003931	missense	probably damaging	1.00
R1295:Atp13a2	UTSW	4	140993802	missense	probably damaging	1.00
R1296:Atp13a2	UTSW	4	140993802	missense	probably damaging	1.00
R1472:Atp13a2	UTSW	4	140993802	missense	probably damaging	1.00
R1780:Atp13a2	UTSW	4	141002460	missense	possibly damaging	0.73
R1837:Atp13a2	UTSW	4	140994332	nonsense	probably null
R1838:Atp13a2	UTSW	4	140994332	nonsense	probably null
R1856:Atp13a2	UTSW	4	141004012	missense	probably benign	0.43
R1918:Atp13a2	UTSW	4	140996371	missense	possibly damaging	0.90
R1956:Atp13a2	UTSW	4	141004261	missense	possibly damaging	0.92
R2126:Atp13a2	UTSW	4	140995391	missense	possibly damaging	0.94
R2130:Atp13a2	UTSW	4	141005016	missense	probably damaging	0.99
R2132:Atp13a2	UTSW	4	141005016	missense	probably damaging	0.99
R2133:Atp13a2	UTSW	4	141005016	missense	probably damaging	0.99
R2397:Atp13a2	UTSW	4	141003155	missense	probably benign	0.00
R2873:Atp13a2	UTSW	4	141002983	missense	probably benign	0.00
R3025:Atp13a2	UTSW	4	140994348	missense	probably damaging	1.00
R3939:Atp13a2	UTSW	4	141006422	missense	probably damaging	0.98
R3940:Atp13a2	UTSW	4	141006422	missense	probably damaging	0.98
R3942:Atp13a2	UTSW	4	141006422	missense	probably damaging	0.98
R4247:Atp13a2	UTSW	4	140992228	critical splice donor site	probably null
R4357:Atp13a2	UTSW	4	141001904	missense	probably benign	0.01
R4406:Atp13a2	UTSW	4	141006476	missense	probably damaging	1.00
R4686:Atp13a2	UTSW	4	141003276	critical splice donor site	probably null
R5033:Atp13a2	UTSW	4	141000821	missense	possibly damaging	0.91
R5066:Atp13a2	UTSW	4	141005138	missense	probably damaging	1.00
R5278:Atp13a2	UTSW	4	141000818	missense	probably damaging	0.97
R5464:Atp13a2	UTSW	4	141006070	missense	probably damaging	1.00
R5522:Atp13a2	UTSW	4	141004360	splice site	probably null
R5614:Atp13a2	UTSW	4	140992182	missense	probably benign	0.35
R5846:Atp13a2	UTSW	4	140995596	missense	possibly damaging	0.81
R6378:Atp13a2	UTSW	4	141007056	missense	probably benign	0.34
R6512:Atp13a2	UTSW	4	141003218	missense	probably damaging	1.00
R6518:Atp13a2	UTSW	4	141000854	missense	possibly damaging	0.89
R6519:Atp13a2	UTSW	4	141000854	missense	possibly damaging	0.89
R7166:Atp13a2	UTSW	4	141006984	missense	possibly damaging	0.89
R7178:Atp13a2	UTSW	4	140999151	missense	probably damaging	1.00
R7657:Atp13a2	UTSW	4	140992504	missense	possibly damaging	0.92
R8256:Atp13a2	UTSW	4	140995611	missense	possibly damaging	0.94
R8313:Atp13a2	UTSW	4	141002735	missense	probably benign
R8318:Atp13a2	UTSW	4	141007024	missense	probably benign	0.14
Z1176:Atp13a2	UTSW	4	141005117	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GTTGAGCTGCTGAGTAACTCTC -3'
(R):5'- AGTACCTGCTTCTGGGTGAG -3'

Sequencing Primer
(F):5'- AACCCTCTCCAGCCTGG -3'
(R):5'- CCTGCTTCTGGGTGAGAGAGG -3'

Posted On

2019-06-07