Incidental Mutation 'PIT4469001:Atp13a2'
ID 555821
Institutional Source Beutler Lab
Gene Symbol Atp13a2
Ensembl Gene ENSMUSG00000036622
Gene Name ATPase type 13A2
Synonyms 1110012E06Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # PIT4469001 (G1)
Quality Score 123.008
Status Not validated
Chromosome 4
Chromosomal Location 140714184-140734641 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 140721438 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 176 (V176E)
Ref Sequence ENSEMBL: ENSMUSP00000126461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037055] [ENSMUST00000127833] [ENSMUST00000168047]
AlphaFold Q9CTG6
Predicted Effect probably benign
Transcript: ENSMUST00000037055
SMART Domains Protein: ENSMUSP00000039648
Gene: ENSMUSG00000036622

DomainStartEndE-ValueType
Pfam:P5-ATPase 31 171 8.9e-27 PFAM
Cation_ATPase_N 179 251 9.78e-1 SMART
Pfam:E1-E2_ATPase 256 497 3.6e-39 PFAM
Pfam:Hydrolase 502 785 2e-14 PFAM
Pfam:HAD 505 876 3.6e-27 PFAM
transmembrane domain 920 942 N/A INTRINSIC
transmembrane domain 957 979 N/A INTRINSIC
transmembrane domain 991 1013 N/A INTRINSIC
transmembrane domain 1033 1055 N/A INTRINSIC
transmembrane domain 1068 1090 N/A INTRINSIC
transmembrane domain 1105 1127 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127833
SMART Domains Protein: ENSMUSP00000132183
Gene: ENSMUSG00000036622

DomainStartEndE-ValueType
Pfam:P5-ATPase 31 164 7.4e-29 PFAM
Cation_ATPase_N 179 251 9.78e-1 SMART
Pfam:E1-E2_ATPase 256 496 6e-34 PFAM
Pfam:HAD 505 876 4e-27 PFAM
Pfam:Hydrolase 663 879 2.5e-15 PFAM
transmembrane domain 925 947 N/A INTRINSIC
transmembrane domain 954 976 N/A INTRINSIC
transmembrane domain 991 1013 N/A INTRINSIC
low complexity region 1102 1115 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000168047
AA Change: V176E
SMART Domains Protein: ENSMUSP00000126461
Gene: ENSMUSG00000036622
AA Change: V176E

DomainStartEndE-ValueType
Pfam:P5-ATPase 31 156 1e-27 PFAM
Cation_ATPase_N 262 334 9.78e-1 SMART
Pfam:E1-E2_ATPase 339 579 4.8e-34 PFAM
Pfam:HAD 588 959 3e-27 PFAM
Pfam:Hydrolase 726 962 1.8e-15 PFAM
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.7%
  • 10x: 84.4%
  • 20x: 71.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the P5 subfamily of ATPases which transports inorganic cations as well as other substrates. Mutations in this gene are associated with Kufor-Rakeb syndrome (KRS), also referred to as Parkinson disease 9. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neuronal ceroid lipofuscinosis, synuclein accumulation and age-dependent sensorimotor deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik A G 1: 85,652,920 (GRCm39) F83L probably benign Het
Acsm2 T A 7: 119,177,408 (GRCm39) C308S possibly damaging Het
Ak3 A G 19: 29,025,157 (GRCm39) S25P probably damaging Het
Bmper A T 9: 23,317,845 (GRCm39) H488L probably benign Het
Cacna1c A T 6: 118,572,933 (GRCm39) C2084S unknown Het
Ccp110 T A 7: 118,321,600 (GRCm39) N418K probably benign Het
Ddx17 C A 15: 79,428,014 (GRCm39) G32C probably damaging Het
Dennd2b G A 7: 109,130,337 (GRCm39) A888V probably damaging Het
Dusp16 G A 6: 134,738,115 (GRCm39) probably benign Het
Efl1 T G 7: 82,307,373 (GRCm39) F90V probably benign Het
Ell2 T A 13: 75,910,011 (GRCm39) N252K probably damaging Het
Gdf6 T C 4: 9,859,569 (GRCm39) V217A probably damaging Het
H1f4 A T 13: 23,806,362 (GRCm39) V40E probably damaging Het
Hint1 T A 11: 54,760,896 (GRCm39) S112T unknown Het
Kif5c T C 2: 49,631,360 (GRCm39) V679A probably benign Het
Lrrn3 A T 12: 41,503,017 (GRCm39) D433E probably benign Het
Mast4 G A 13: 102,941,226 (GRCm39) T277M probably damaging Het
Naa11 A G 5: 97,539,485 (GRCm39) probably null Het
Pcdh18 T A 3: 49,709,518 (GRCm39) H599L probably benign Het
Pgc A T 17: 48,039,680 (GRCm39) K25* probably null Het
Pramel58 T A 5: 94,830,652 (GRCm39) V50E probably damaging Het
Psd4 G A 2: 24,284,306 (GRCm39) D57N probably benign Het
Pxdn G A 12: 30,055,828 (GRCm39) R1238Q probably benign Het
Smim41 T C 15: 101,191,152 (GRCm39) V6A probably benign Het
Spata32 T C 11: 103,100,653 (GRCm39) N38S probably benign Het
Tpr A G 1: 150,279,707 (GRCm39) T279A probably benign Het
Unc13a C A 8: 72,110,958 (GRCm39) E418* probably null Het
Vmn2r97 C A 17: 19,149,878 (GRCm39) T422K probably benign Het
Zfp474 A T 18: 52,771,791 (GRCm39) Q148L possibly damaging Het
Other mutations in Atp13a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Atp13a2 APN 4 140,719,509 (GRCm39) missense probably benign 0.02
IGL01476:Atp13a2 APN 4 140,728,081 (GRCm39) missense probably damaging 1.00
IGL01980:Atp13a2 APN 4 140,733,463 (GRCm39) missense probably benign 0.00
IGL02257:Atp13a2 APN 4 140,733,400 (GRCm39) missense probably benign 0.00
IGL02589:Atp13a2 APN 4 140,733,722 (GRCm39) missense probably damaging 1.00
IGL02936:Atp13a2 APN 4 140,729,260 (GRCm39) missense probably benign 0.00
IGL03032:Atp13a2 APN 4 140,727,666 (GRCm39) missense possibly damaging 0.95
IGL03040:Atp13a2 APN 4 140,733,484 (GRCm39) missense probably damaging 1.00
IGL03271:Atp13a2 APN 4 140,727,708 (GRCm39) missense possibly damaging 0.69
calla UTSW 4 140,721,643 (GRCm39) nonsense probably null
eastern_moon UTSW 4 140,732,327 (GRCm39) missense probably damaging 0.99
yucca_brevifolia UTSW 4 140,721,113 (GRCm39) missense probably damaging 1.00
IGL03054:Atp13a2 UTSW 4 140,734,279 (GRCm39) missense possibly damaging 0.83
R0634:Atp13a2 UTSW 4 140,734,240 (GRCm39) unclassified probably benign
R0881:Atp13a2 UTSW 4 140,731,242 (GRCm39) missense probably damaging 1.00
R1295:Atp13a2 UTSW 4 140,721,113 (GRCm39) missense probably damaging 1.00
R1296:Atp13a2 UTSW 4 140,721,113 (GRCm39) missense probably damaging 1.00
R1472:Atp13a2 UTSW 4 140,721,113 (GRCm39) missense probably damaging 1.00
R1780:Atp13a2 UTSW 4 140,729,771 (GRCm39) missense possibly damaging 0.73
R1837:Atp13a2 UTSW 4 140,721,643 (GRCm39) nonsense probably null
R1838:Atp13a2 UTSW 4 140,721,643 (GRCm39) nonsense probably null
R1856:Atp13a2 UTSW 4 140,731,323 (GRCm39) missense probably benign 0.43
R1918:Atp13a2 UTSW 4 140,723,682 (GRCm39) missense possibly damaging 0.90
R1956:Atp13a2 UTSW 4 140,731,572 (GRCm39) missense possibly damaging 0.92
R2126:Atp13a2 UTSW 4 140,722,702 (GRCm39) missense possibly damaging 0.94
R2130:Atp13a2 UTSW 4 140,732,327 (GRCm39) missense probably damaging 0.99
R2132:Atp13a2 UTSW 4 140,732,327 (GRCm39) missense probably damaging 0.99
R2133:Atp13a2 UTSW 4 140,732,327 (GRCm39) missense probably damaging 0.99
R2397:Atp13a2 UTSW 4 140,730,466 (GRCm39) missense probably benign 0.00
R2873:Atp13a2 UTSW 4 140,730,294 (GRCm39) missense probably benign 0.00
R3025:Atp13a2 UTSW 4 140,721,659 (GRCm39) missense probably damaging 1.00
R3939:Atp13a2 UTSW 4 140,733,733 (GRCm39) missense probably damaging 0.98
R3940:Atp13a2 UTSW 4 140,733,733 (GRCm39) missense probably damaging 0.98
R3942:Atp13a2 UTSW 4 140,733,733 (GRCm39) missense probably damaging 0.98
R4247:Atp13a2 UTSW 4 140,719,539 (GRCm39) critical splice donor site probably null
R4357:Atp13a2 UTSW 4 140,729,215 (GRCm39) missense probably benign 0.01
R4406:Atp13a2 UTSW 4 140,733,787 (GRCm39) missense probably damaging 1.00
R4686:Atp13a2 UTSW 4 140,730,587 (GRCm39) critical splice donor site probably null
R5033:Atp13a2 UTSW 4 140,728,132 (GRCm39) missense possibly damaging 0.91
R5066:Atp13a2 UTSW 4 140,732,449 (GRCm39) missense probably damaging 1.00
R5278:Atp13a2 UTSW 4 140,728,129 (GRCm39) missense probably damaging 0.97
R5464:Atp13a2 UTSW 4 140,733,381 (GRCm39) missense probably damaging 1.00
R5522:Atp13a2 UTSW 4 140,731,671 (GRCm39) splice site probably null
R5614:Atp13a2 UTSW 4 140,719,493 (GRCm39) missense probably benign 0.35
R5846:Atp13a2 UTSW 4 140,722,907 (GRCm39) missense possibly damaging 0.81
R6378:Atp13a2 UTSW 4 140,734,367 (GRCm39) missense probably benign 0.34
R6512:Atp13a2 UTSW 4 140,730,529 (GRCm39) missense probably damaging 1.00
R6518:Atp13a2 UTSW 4 140,728,165 (GRCm39) missense possibly damaging 0.89
R6519:Atp13a2 UTSW 4 140,728,165 (GRCm39) missense possibly damaging 0.89
R7166:Atp13a2 UTSW 4 140,734,295 (GRCm39) missense possibly damaging 0.89
R7178:Atp13a2 UTSW 4 140,726,462 (GRCm39) missense probably damaging 1.00
R7657:Atp13a2 UTSW 4 140,719,815 (GRCm39) missense possibly damaging 0.92
R8256:Atp13a2 UTSW 4 140,722,922 (GRCm39) missense possibly damaging 0.94
R8313:Atp13a2 UTSW 4 140,730,046 (GRCm39) missense probably benign
R8318:Atp13a2 UTSW 4 140,734,335 (GRCm39) missense probably benign 0.14
R8781:Atp13a2 UTSW 4 140,723,691 (GRCm39) missense probably benign 0.36
R9142:Atp13a2 UTSW 4 140,729,364 (GRCm39) missense probably damaging 1.00
R9145:Atp13a2 UTSW 4 140,724,056 (GRCm39) missense probably damaging 0.99
R9158:Atp13a2 UTSW 4 140,724,112 (GRCm39) critical splice donor site probably null
R9256:Atp13a2 UTSW 4 140,730,038 (GRCm39) missense probably damaging 0.98
R9339:Atp13a2 UTSW 4 140,730,571 (GRCm39) missense probably benign 0.00
Z1176:Atp13a2 UTSW 4 140,732,428 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTGAGCTGCTGAGTAACTCTC -3'
(R):5'- AGTACCTGCTTCTGGGTGAG -3'

Sequencing Primer
(F):5'- AACCCTCTCCAGCCTGG -3'
(R):5'- CCTGCTTCTGGGTGAGAGAGG -3'
Posted On 2019-06-07