Incidental Mutation 'PIT4469001:Efl1'
ID 555826
Institutional Source Beutler Lab
Gene Symbol Efl1
Ensembl Gene ENSMUSG00000038563
Gene Name elongation factor like GTPase 1
Synonyms D7Ertd791e, 6030468D11Rik, 4932434J20Rik, Eftud1
Accession Numbers
Essential gene? Probably essential (E-score: 0.878) question?
Stock # PIT4469001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 82297822-82427060 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 82307373 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Valine at position 90 (F90V)
Ref Sequence ENSEMBL: ENSMUSP00000146350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039881] [ENSMUST00000141726] [ENSMUST00000179489] [ENSMUST00000207868]
AlphaFold Q8C0D5
Predicted Effect probably benign
Transcript: ENSMUST00000039881
SMART Domains Protein: ENSMUSP00000046046
Gene: ENSMUSG00000038563

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 365 7.4e-62 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:EFG_II 614 687 4.3e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141726
SMART Domains Protein: ENSMUSP00000121909
Gene: ENSMUSG00000038563

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 222 2.3e-57 PFAM
Pfam:MMR_HSR1 21 147 2e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179489
SMART Domains Protein: ENSMUSP00000137061
Gene: ENSMUSG00000038563

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 364 8.7e-58 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:GTP_EFTU_D2 504 599 1e-7 PFAM
Pfam:EFG_II 614 687 1.8e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207868
AA Change: F90V

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.7%
  • 10x: 84.4%
  • 20x: 71.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit late-onset and progressive gait abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik A G 1: 85,652,920 (GRCm39) F83L probably benign Het
Acsm2 T A 7: 119,177,408 (GRCm39) C308S possibly damaging Het
Ak3 A G 19: 29,025,157 (GRCm39) S25P probably damaging Het
Atp13a2 T A 4: 140,721,438 (GRCm39) V176E unknown Het
Bmper A T 9: 23,317,845 (GRCm39) H488L probably benign Het
Cacna1c A T 6: 118,572,933 (GRCm39) C2084S unknown Het
Ccp110 T A 7: 118,321,600 (GRCm39) N418K probably benign Het
Ddx17 C A 15: 79,428,014 (GRCm39) G32C probably damaging Het
Dennd2b G A 7: 109,130,337 (GRCm39) A888V probably damaging Het
Dusp16 G A 6: 134,738,115 (GRCm39) probably benign Het
Ell2 T A 13: 75,910,011 (GRCm39) N252K probably damaging Het
Gdf6 T C 4: 9,859,569 (GRCm39) V217A probably damaging Het
H1f4 A T 13: 23,806,362 (GRCm39) V40E probably damaging Het
Hint1 T A 11: 54,760,896 (GRCm39) S112T unknown Het
Kif5c T C 2: 49,631,360 (GRCm39) V679A probably benign Het
Lrrn3 A T 12: 41,503,017 (GRCm39) D433E probably benign Het
Mast4 G A 13: 102,941,226 (GRCm39) T277M probably damaging Het
Naa11 A G 5: 97,539,485 (GRCm39) probably null Het
Pcdh18 T A 3: 49,709,518 (GRCm39) H599L probably benign Het
Pgc A T 17: 48,039,680 (GRCm39) K25* probably null Het
Pramel58 T A 5: 94,830,652 (GRCm39) V50E probably damaging Het
Psd4 G A 2: 24,284,306 (GRCm39) D57N probably benign Het
Pxdn G A 12: 30,055,828 (GRCm39) R1238Q probably benign Het
Smim41 T C 15: 101,191,152 (GRCm39) V6A probably benign Het
Spata32 T C 11: 103,100,653 (GRCm39) N38S probably benign Het
Tpr A G 1: 150,279,707 (GRCm39) T279A probably benign Het
Unc13a C A 8: 72,110,958 (GRCm39) E418* probably null Het
Vmn2r97 C A 17: 19,149,878 (GRCm39) T422K probably benign Het
Zfp474 A T 18: 52,771,791 (GRCm39) Q148L possibly damaging Het
Other mutations in Efl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00541:Efl1 APN 7 82,307,319 (GRCm39) missense probably damaging 1.00
IGL00696:Efl1 APN 7 82,301,080 (GRCm39) splice site probably benign
IGL01344:Efl1 APN 7 82,330,688 (GRCm39) splice site probably benign
IGL01871:Efl1 APN 7 82,412,527 (GRCm39) missense possibly damaging 0.64
IGL01941:Efl1 APN 7 82,347,184 (GRCm39) missense probably benign 0.17
IGL02104:Efl1 APN 7 82,307,263 (GRCm39) critical splice acceptor site probably null
IGL02150:Efl1 APN 7 82,335,899 (GRCm39) missense probably benign
IGL02484:Efl1 APN 7 82,332,247 (GRCm39) missense probably damaging 0.98
IGL03140:Efl1 APN 7 82,342,089 (GRCm39) missense probably benign 0.00
IGL03188:Efl1 APN 7 82,320,909 (GRCm39) missense probably damaging 1.00
IGL03014:Efl1 UTSW 7 82,301,094 (GRCm39) missense probably damaging 1.00
R0148:Efl1 UTSW 7 82,320,878 (GRCm39) missense probably damaging 1.00
R0226:Efl1 UTSW 7 82,342,219 (GRCm39) splice site probably benign
R0638:Efl1 UTSW 7 82,301,095 (GRCm39) missense probably damaging 1.00
R0684:Efl1 UTSW 7 82,301,094 (GRCm39) missense probably damaging 1.00
R1018:Efl1 UTSW 7 82,412,221 (GRCm39) missense possibly damaging 0.94
R1290:Efl1 UTSW 7 82,320,936 (GRCm39) missense probably damaging 1.00
R1720:Efl1 UTSW 7 82,332,929 (GRCm39) missense possibly damaging 0.50
R1933:Efl1 UTSW 7 82,412,325 (GRCm39) nonsense probably null
R1973:Efl1 UTSW 7 82,412,085 (GRCm39) missense probably damaging 1.00
R2016:Efl1 UTSW 7 82,402,917 (GRCm39) missense probably damaging 1.00
R2124:Efl1 UTSW 7 82,342,121 (GRCm39) missense probably damaging 1.00
R2290:Efl1 UTSW 7 82,426,878 (GRCm39) missense probably damaging 1.00
R2415:Efl1 UTSW 7 82,347,175 (GRCm39) missense probably damaging 1.00
R3545:Efl1 UTSW 7 82,412,018 (GRCm39) missense probably benign 0.00
R3688:Efl1 UTSW 7 82,412,178 (GRCm39) missense probably benign 0.00
R4092:Efl1 UTSW 7 82,412,035 (GRCm39) missense probably benign 0.00
R4207:Efl1 UTSW 7 82,400,024 (GRCm39) missense probably damaging 0.98
R4347:Efl1 UTSW 7 82,347,174 (GRCm39) missense probably damaging 1.00
R4425:Efl1 UTSW 7 82,412,491 (GRCm39) missense probably damaging 0.99
R4816:Efl1 UTSW 7 82,320,927 (GRCm39) missense probably damaging 1.00
R4858:Efl1 UTSW 7 82,320,835 (GRCm39) missense probably damaging 1.00
R5077:Efl1 UTSW 7 82,307,295 (GRCm39) missense probably damaging 1.00
R5185:Efl1 UTSW 7 82,421,707 (GRCm39) missense probably damaging 1.00
R5319:Efl1 UTSW 7 82,323,714 (GRCm39) missense probably damaging 1.00
R5771:Efl1 UTSW 7 82,341,732 (GRCm39) missense probably benign 0.26
R5857:Efl1 UTSW 7 82,412,397 (GRCm39) missense probably benign
R5956:Efl1 UTSW 7 82,301,107 (GRCm39) missense probably damaging 1.00
R6433:Efl1 UTSW 7 82,323,776 (GRCm39) missense probably damaging 1.00
R7131:Efl1 UTSW 7 82,307,272 (GRCm39) missense probably damaging 1.00
R7143:Efl1 UTSW 7 82,411,888 (GRCm39) missense probably damaging 1.00
R7312:Efl1 UTSW 7 82,330,652 (GRCm39) missense probably benign 0.10
R7409:Efl1 UTSW 7 82,347,121 (GRCm39) missense probably damaging 0.98
R7422:Efl1 UTSW 7 82,330,587 (GRCm39) missense probably damaging 1.00
R7453:Efl1 UTSW 7 82,330,675 (GRCm39) missense possibly damaging 0.76
R7504:Efl1 UTSW 7 82,332,257 (GRCm39) missense probably damaging 1.00
R7884:Efl1 UTSW 7 82,307,307 (GRCm39) missense probably damaging 1.00
R7969:Efl1 UTSW 7 82,342,178 (GRCm39) missense probably benign 0.03
R8394:Efl1 UTSW 7 82,411,986 (GRCm39) missense probably benign 0.00
R8702:Efl1 UTSW 7 82,399,998 (GRCm39) critical splice acceptor site probably null
R8924:Efl1 UTSW 7 82,412,161 (GRCm39) missense probably benign 0.03
R9463:Efl1 UTSW 7 82,426,733 (GRCm39) missense probably damaging 1.00
R9762:Efl1 UTSW 7 82,412,596 (GRCm39) missense probably benign 0.09
Z1088:Efl1 UTSW 7 82,342,058 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAGCAACAGTCTGGGGATG -3'
(R):5'- CTCAAGTCAGTCAGAGGTTCC -3'

Sequencing Primer
(F):5'- GGGTGCATTTGTGACATCTTACAAC -3'
(R):5'- AAGTCAGTCAGAGGTTCCCATCTG -3'
Posted On 2019-06-07