Incidental Mutation 'PIT4469001:Dennd2b'
ID 555827
Institutional Source Beutler Lab
Gene Symbol Dennd2b
Ensembl Gene ENSMUSG00000031024
Gene Name DENN domain containing 2B
Synonyms Denn2b, 2610305K15Rik, St5, 2010004M01Rik
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.390) question?
Stock # PIT4469001 (G1)
Quality Score 222.001
Status Not validated
Chromosome 7
Chromosomal Location 109123118-109302812 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 109130337 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 888 (A888V)
Ref Sequence ENSEMBL: ENSMUSP00000077067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077909] [ENSMUST00000079282] [ENSMUST00000084738] [ENSMUST00000168005]
AlphaFold Q924W7
Predicted Effect probably damaging
Transcript: ENSMUST00000077909
AA Change: A888V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077067
Gene: ENSMUSG00000031024
AA Change: A888V

DomainStartEndE-ValueType
low complexity region 28 46 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 314 326 N/A INTRINSIC
low complexity region 327 348 N/A INTRINSIC
low complexity region 365 379 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
low complexity region 577 609 N/A INTRINSIC
low complexity region 624 638 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
uDENN 690 781 1.16e-30 SMART
DENN 788 972 7.84e-78 SMART
low complexity region 1007 1014 N/A INTRINSIC
dDENN 1019 1086 3.12e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000079282
AA Change: A888V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078264
Gene: ENSMUSG00000031024
AA Change: A888V

DomainStartEndE-ValueType
low complexity region 28 46 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 314 326 N/A INTRINSIC
low complexity region 327 348 N/A INTRINSIC
low complexity region 365 379 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
low complexity region 577 609 N/A INTRINSIC
low complexity region 624 638 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
uDENN 690 781 1.16e-30 SMART
DENN 788 972 7.84e-78 SMART
low complexity region 1007 1014 N/A INTRINSIC
dDENN 1019 1086 3.12e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000084738
AA Change: A471V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000081789
Gene: ENSMUSG00000031024
AA Change: A471V

DomainStartEndE-ValueType
low complexity region 160 192 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
low complexity region 228 239 N/A INTRINSIC
uDENN 273 364 1.16e-30 SMART
DENN 371 555 7.84e-78 SMART
low complexity region 590 597 N/A INTRINSIC
dDENN 602 669 3.12e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168005
AA Change: A471V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130119
Gene: ENSMUSG00000031024
AA Change: A471V

DomainStartEndE-ValueType
low complexity region 160 192 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
low complexity region 228 239 N/A INTRINSIC
uDENN 273 364 1.16e-30 SMART
DENN 371 555 7.84e-78 SMART
low complexity region 590 597 N/A INTRINSIC
dDENN 602 669 3.12e-22 SMART
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.7%
  • 10x: 84.4%
  • 20x: 71.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its ability to suppress the tumorigenicity of Hela cells in nude mice. The protein encoded by this gene contains a C-terminal region that shares similarity with the Rab 3 family of small GTP binding proteins. This protein preferentially binds to the SH3 domain of c-Abl kinase, and acts as a regulator of MAPK1/ERK2 kinase, which may contribute to its ability to reduce the tumorigenic phenotype in cells. Three alternatively spliced transcript variants of this gene encoding distinct isoforms are identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik A G 1: 85,652,920 (GRCm39) F83L probably benign Het
Acsm2 T A 7: 119,177,408 (GRCm39) C308S possibly damaging Het
Ak3 A G 19: 29,025,157 (GRCm39) S25P probably damaging Het
Atp13a2 T A 4: 140,721,438 (GRCm39) V176E unknown Het
Bmper A T 9: 23,317,845 (GRCm39) H488L probably benign Het
Cacna1c A T 6: 118,572,933 (GRCm39) C2084S unknown Het
Ccp110 T A 7: 118,321,600 (GRCm39) N418K probably benign Het
Ddx17 C A 15: 79,428,014 (GRCm39) G32C probably damaging Het
Dusp16 G A 6: 134,738,115 (GRCm39) probably benign Het
Efl1 T G 7: 82,307,373 (GRCm39) F90V probably benign Het
Ell2 T A 13: 75,910,011 (GRCm39) N252K probably damaging Het
Gdf6 T C 4: 9,859,569 (GRCm39) V217A probably damaging Het
H1f4 A T 13: 23,806,362 (GRCm39) V40E probably damaging Het
Hint1 T A 11: 54,760,896 (GRCm39) S112T unknown Het
Kif5c T C 2: 49,631,360 (GRCm39) V679A probably benign Het
Lrrn3 A T 12: 41,503,017 (GRCm39) D433E probably benign Het
Mast4 G A 13: 102,941,226 (GRCm39) T277M probably damaging Het
Naa11 A G 5: 97,539,485 (GRCm39) probably null Het
Pcdh18 T A 3: 49,709,518 (GRCm39) H599L probably benign Het
Pgc A T 17: 48,039,680 (GRCm39) K25* probably null Het
Pramel58 T A 5: 94,830,652 (GRCm39) V50E probably damaging Het
Psd4 G A 2: 24,284,306 (GRCm39) D57N probably benign Het
Pxdn G A 12: 30,055,828 (GRCm39) R1238Q probably benign Het
Smim41 T C 15: 101,191,152 (GRCm39) V6A probably benign Het
Spata32 T C 11: 103,100,653 (GRCm39) N38S probably benign Het
Tpr A G 1: 150,279,707 (GRCm39) T279A probably benign Het
Unc13a C A 8: 72,110,958 (GRCm39) E418* probably null Het
Vmn2r97 C A 17: 19,149,878 (GRCm39) T422K probably benign Het
Zfp474 A T 18: 52,771,791 (GRCm39) Q148L possibly damaging Het
Other mutations in Dennd2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Dennd2b APN 7 109,126,915 (GRCm39) missense possibly damaging 0.71
IGL01132:Dennd2b APN 7 109,169,212 (GRCm39) splice site probably null
IGL01288:Dennd2b APN 7 109,139,029 (GRCm39) missense probably damaging 0.96
IGL01645:Dennd2b APN 7 109,126,841 (GRCm39) nonsense probably null
IGL01714:Dennd2b APN 7 109,169,269 (GRCm39) missense probably damaging 0.99
IGL02021:Dennd2b APN 7 109,156,579 (GRCm39) missense probably damaging 1.00
IGL02302:Dennd2b APN 7 109,124,538 (GRCm39) missense probably damaging 1.00
IGL02496:Dennd2b APN 7 109,155,442 (GRCm39) missense possibly damaging 0.83
IGL02795:Dennd2b APN 7 109,155,571 (GRCm39) missense probably damaging 1.00
Bucolic UTSW 7 109,124,755 (GRCm39) nonsense probably null
Halcyon UTSW 7 109,156,000 (GRCm39) nonsense probably null
FR4340:Dennd2b UTSW 7 109,156,128 (GRCm39) unclassified probably benign
FR4737:Dennd2b UTSW 7 109,156,128 (GRCm39) unclassified probably benign
PIT4466001:Dennd2b UTSW 7 109,130,337 (GRCm39) missense probably damaging 1.00
PIT4472001:Dennd2b UTSW 7 109,130,337 (GRCm39) missense probably damaging 1.00
R0024:Dennd2b UTSW 7 109,123,866 (GRCm39) missense probably damaging 1.00
R0124:Dennd2b UTSW 7 109,141,718 (GRCm39) missense possibly damaging 0.66
R0125:Dennd2b UTSW 7 109,155,545 (GRCm39) missense probably benign 0.19
R0365:Dennd2b UTSW 7 109,138,156 (GRCm39) missense probably damaging 1.00
R0491:Dennd2b UTSW 7 109,156,411 (GRCm39) missense probably benign 0.45
R0534:Dennd2b UTSW 7 109,140,635 (GRCm39) missense probably damaging 1.00
R0662:Dennd2b UTSW 7 109,156,633 (GRCm39) missense probably damaging 1.00
R0743:Dennd2b UTSW 7 109,156,552 (GRCm39) missense probably damaging 1.00
R0772:Dennd2b UTSW 7 109,141,527 (GRCm39) splice site probably null
R0774:Dennd2b UTSW 7 109,141,527 (GRCm39) splice site probably null
R0787:Dennd2b UTSW 7 109,124,827 (GRCm39) missense possibly damaging 0.94
R0884:Dennd2b UTSW 7 109,156,552 (GRCm39) missense probably damaging 1.00
R1518:Dennd2b UTSW 7 109,156,562 (GRCm39) missense probably damaging 1.00
R1908:Dennd2b UTSW 7 109,124,533 (GRCm39) nonsense probably null
R1909:Dennd2b UTSW 7 109,124,533 (GRCm39) nonsense probably null
R2232:Dennd2b UTSW 7 109,156,414 (GRCm39) missense probably benign
R2358:Dennd2b UTSW 7 109,155,653 (GRCm39) missense probably benign 0.01
R2847:Dennd2b UTSW 7 109,124,544 (GRCm39) missense probably damaging 1.00
R2869:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2869:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2870:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2870:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2871:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2871:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2873:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2874:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R4534:Dennd2b UTSW 7 109,130,363 (GRCm39) missense probably damaging 1.00
R4536:Dennd2b UTSW 7 109,130,363 (GRCm39) missense probably damaging 1.00
R4559:Dennd2b UTSW 7 109,124,785 (GRCm39) missense probably damaging 1.00
R4798:Dennd2b UTSW 7 109,156,240 (GRCm39) missense probably damaging 0.99
R4846:Dennd2b UTSW 7 109,156,043 (GRCm39) nonsense probably null
R5110:Dennd2b UTSW 7 109,141,697 (GRCm39) missense probably benign 0.02
R5181:Dennd2b UTSW 7 109,155,997 (GRCm39) missense probably benign
R5268:Dennd2b UTSW 7 109,156,519 (GRCm39) missense probably benign
R5403:Dennd2b UTSW 7 109,156,112 (GRCm39) missense probably damaging 1.00
R5836:Dennd2b UTSW 7 109,140,552 (GRCm39) missense possibly damaging 0.78
R5932:Dennd2b UTSW 7 109,169,223 (GRCm39) missense probably damaging 1.00
R5937:Dennd2b UTSW 7 109,156,478 (GRCm39) missense possibly damaging 0.86
R6180:Dennd2b UTSW 7 109,156,095 (GRCm39) missense probably benign 0.11
R6741:Dennd2b UTSW 7 109,144,304 (GRCm39) missense possibly damaging 0.95
R6781:Dennd2b UTSW 7 109,124,511 (GRCm39) missense possibly damaging 0.83
R7086:Dennd2b UTSW 7 109,124,781 (GRCm39) missense probably damaging 1.00
R7466:Dennd2b UTSW 7 109,124,553 (GRCm39) missense probably damaging 1.00
R7644:Dennd2b UTSW 7 109,156,000 (GRCm39) nonsense probably null
R8354:Dennd2b UTSW 7 109,124,755 (GRCm39) nonsense probably null
R8745:Dennd2b UTSW 7 109,156,279 (GRCm39) missense probably benign 0.02
R8859:Dennd2b UTSW 7 109,123,863 (GRCm39) missense probably damaging 1.00
R9016:Dennd2b UTSW 7 109,139,642 (GRCm39) missense possibly damaging 0.84
R9178:Dennd2b UTSW 7 109,156,291 (GRCm39) missense probably benign 0.31
R9361:Dennd2b UTSW 7 109,126,991 (GRCm39) missense probably damaging 1.00
R9564:Dennd2b UTSW 7 109,125,536 (GRCm39) missense probably damaging 1.00
R9595:Dennd2b UTSW 7 109,155,973 (GRCm39) missense probably damaging 0.96
RF062:Dennd2b UTSW 7 109,156,153 (GRCm39) unclassified probably benign
X0067:Dennd2b UTSW 7 109,155,447 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATTTACCGTGACAATGCACAC -3'
(R):5'- TGGGTCTCCTGCATCGTAAG -3'

Sequencing Primer
(F):5'- CGTGACAATGCACACACATAAGTAGG -3'
(R):5'- TCGTAAGAGGATTGGAAGCCTTG -3'
Posted On 2019-06-07