Incidental Mutation 'PIT4469001:Ccp110'
ID555828
Institutional Source Beutler Lab
Gene Symbol Ccp110
Ensembl Gene ENSMUSG00000033904
Gene Namecentriolar coiled coil protein 110
Synonyms6330503K22Rik, CP110
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.901) question?
Stock #PIT4469001 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location118712552-118737024 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118722377 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 418 (N418K)
Ref Sequence ENSEMBL: ENSMUSP00000102167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038650] [ENSMUST00000106557]
Predicted Effect probably benign
Transcript: ENSMUST00000038650
AA Change: N418K

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000038881
Gene: ENSMUSG00000033904
AA Change: N418K

DomainStartEndE-ValueType
Pfam:CALM_bind 29 135 7.4e-21 PFAM
low complexity region 241 253 N/A INTRINSIC
low complexity region 325 337 N/A INTRINSIC
coiled coil region 642 699 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106557
AA Change: N418K

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000102167
Gene: ENSMUSG00000033904
AA Change: N418K

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
low complexity region 241 253 N/A INTRINSIC
low complexity region 325 337 N/A INTRINSIC
coiled coil region 642 699 N/A INTRINSIC
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000208766
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.7%
  • 10x: 84.4%
  • 20x: 71.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit pleiotropic phenotypes due to impaired sonic hedgehog (Shh) signaling and failure of primary cilia formation in multiple tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030408B16Rik T C 15: 101,293,271 V6A probably benign Het
A630001G21Rik A G 1: 85,725,199 F83L probably benign Het
Acsm2 T A 7: 119,578,185 C308S possibly damaging Het
Ak3 A G 19: 29,047,757 S25P probably damaging Het
Atp13a2 T A 4: 140,994,127 V176E unknown Het
Bmper A T 9: 23,406,549 H488L probably benign Het
Cacna1c A T 6: 118,595,972 C2084S unknown Het
Ddx17 C A 15: 79,543,813 G32C probably damaging Het
Dusp16 G A 6: 134,761,152 probably benign Het
Efl1 T G 7: 82,658,165 F90V probably benign Het
Ell2 T A 13: 75,761,892 N252K probably damaging Het
Gdf6 T C 4: 9,859,569 V217A probably damaging Het
Gm6205 T A 5: 94,682,793 V50E probably damaging Het
Hint1 T A 11: 54,870,070 S112T unknown Het
Hist1h1e A T 13: 23,622,379 V40E probably damaging Het
Kif5c T C 2: 49,741,348 V679A probably benign Het
Lrrn3 A T 12: 41,453,018 D433E probably benign Het
Mast4 G A 13: 102,804,718 T277M probably damaging Het
Naa11 A G 5: 97,391,626 probably null Het
Pcdh18 T A 3: 49,755,069 H599L probably benign Het
Pgc A T 17: 47,728,755 K25* probably null Het
Psd4 G A 2: 24,394,294 D57N probably benign Het
Pxdn G A 12: 30,005,829 R1238Q probably benign Het
Spata32 T C 11: 103,209,827 N38S probably benign Het
St5 G A 7: 109,531,130 A888V probably damaging Het
Tpr A G 1: 150,403,956 T279A probably benign Het
Unc13a C A 8: 71,658,314 E418* probably null Het
Vmn2r97 C A 17: 18,929,616 T422K probably benign Het
Zfp474 A T 18: 52,638,719 Q148L possibly damaging Het
Other mutations in Ccp110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ccp110 APN 7 118722424 missense possibly damaging 0.79
IGL00481:Ccp110 APN 7 118729997 missense possibly damaging 0.70
IGL00725:Ccp110 APN 7 118730723 missense probably damaging 0.99
IGL00899:Ccp110 APN 7 118722684 missense probably benign
IGL01837:Ccp110 APN 7 118725461 critical splice donor site probably null
R1217:Ccp110 UTSW 7 118729944 splice site probably benign
R1640:Ccp110 UTSW 7 118715528 splice site probably null
R1700:Ccp110 UTSW 7 118735313 missense probably damaging 0.99
R1768:Ccp110 UTSW 7 118726024 splice site probably null
R4737:Ccp110 UTSW 7 118724548 missense possibly damaging 0.96
R4859:Ccp110 UTSW 7 118725430 missense possibly damaging 0.93
R4933:Ccp110 UTSW 7 118725319 missense probably damaging 0.96
R4970:Ccp110 UTSW 7 118722391 missense possibly damaging 0.85
R4999:Ccp110 UTSW 7 118730012 nonsense probably null
R5212:Ccp110 UTSW 7 118729696 missense probably damaging 0.99
R5600:Ccp110 UTSW 7 118729725 critical splice donor site probably null
R6953:Ccp110 UTSW 7 118722421 missense possibly damaging 0.85
R6998:Ccp110 UTSW 7 118732897 missense possibly damaging 0.91
R7076:Ccp110 UTSW 7 118732405 missense probably damaging 1.00
R7092:Ccp110 UTSW 7 118735271 missense probably benign 0.26
R7336:Ccp110 UTSW 7 118722210 missense probably damaging 0.99
R7343:Ccp110 UTSW 7 118724575 missense probably benign 0.03
R7866:Ccp110 UTSW 7 118723018 missense probably benign 0.07
R8306:Ccp110 UTSW 7 118722680 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TACCTAGTCCAGAGCCAAGTATG -3'
(R):5'- ACAAGTACCGTCCACCTTCTGG -3'

Sequencing Primer
(F):5'- GCCAAGTATGAGTCCTACGATGC -3'
(R):5'- GTCATCAGCTATGAAGGGACCTTC -3'
Posted On2019-06-07