Incidental Mutation 'PIT4469001:Bmper'
ID555831
Institutional Source Beutler Lab
Gene Symbol Bmper
Ensembl Gene ENSMUSG00000031963
Gene NameBMP-binding endothelial regulator
SynonymsCV-2, Crim3, 3110056H04Rik, crossveinless-2, Cv2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4469001 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location23223076-23485200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23406549 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 488 (H488L)
Ref Sequence ENSEMBL: ENSMUSP00000071872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071982]
Predicted Effect probably benign
Transcript: ENSMUST00000071982
AA Change: H488L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000071872
Gene: ENSMUSG00000031963
AA Change: H488L

DomainStartEndE-ValueType
VWC 50 105 1.57e-2 SMART
VWC 108 163 1.89e-1 SMART
VWC 166 224 7.27e-7 SMART
VWC 238 289 3.34e-6 SMART
VWC 301 357 1.7e-7 SMART
VWD 355 513 3.75e-41 SMART
C8 553 625 1.07e-14 SMART
Pfam:TIL 629 682 2.5e-13 PFAM
Predicted Effect
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.7%
  • 10x: 84.4%
  • 20x: 71.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted protein that contains five Von Willebrand factor type C domains and a Von Willebrand factor type D domain and a trypsin inhibitory-like domain. The encoded protein binds to bone morphogenetic proteins (BMP) and regulates their activity. Mutation of the related gene in humans causes diaphanospondylodysostosis. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a knock-out mutation exhibit neonatal lethality associated with abnormal lung and skeleton development. Mice heterozygous for a null allele exhibit abnromal lung development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030408B16Rik T C 15: 101,293,271 V6A probably benign Het
A630001G21Rik A G 1: 85,725,199 F83L probably benign Het
Acsm2 T A 7: 119,578,185 C308S possibly damaging Het
Ak3 A G 19: 29,047,757 S25P probably damaging Het
Atp13a2 T A 4: 140,994,127 V176E unknown Het
Cacna1c A T 6: 118,595,972 C2084S unknown Het
Ccp110 T A 7: 118,722,377 N418K probably benign Het
Ddx17 C A 15: 79,543,813 G32C probably damaging Het
Dusp16 G A 6: 134,761,152 probably benign Het
Efl1 T G 7: 82,658,165 F90V probably benign Het
Ell2 T A 13: 75,761,892 N252K probably damaging Het
Gdf6 T C 4: 9,859,569 V217A probably damaging Het
Gm6205 T A 5: 94,682,793 V50E probably damaging Het
Hint1 T A 11: 54,870,070 S112T unknown Het
Hist1h1e A T 13: 23,622,379 V40E probably damaging Het
Kif5c T C 2: 49,741,348 V679A probably benign Het
Lrrn3 A T 12: 41,453,018 D433E probably benign Het
Mast4 G A 13: 102,804,718 T277M probably damaging Het
Naa11 A G 5: 97,391,626 probably null Het
Pcdh18 T A 3: 49,755,069 H599L probably benign Het
Pgc A T 17: 47,728,755 K25* probably null Het
Psd4 G A 2: 24,394,294 D57N probably benign Het
Pxdn G A 12: 30,005,829 R1238Q probably benign Het
Spata32 T C 11: 103,209,827 N38S probably benign Het
St5 G A 7: 109,531,130 A888V probably damaging Het
Tpr A G 1: 150,403,956 T279A probably benign Het
Unc13a C A 8: 71,658,314 E418* probably null Het
Vmn2r97 C A 17: 18,929,616 T422K probably benign Het
Zfp474 A T 18: 52,638,719 Q148L possibly damaging Het
Other mutations in Bmper
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Bmper APN 9 23406527 missense probably damaging 1.00
IGL00576:Bmper APN 9 23406603 missense probably damaging 1.00
IGL01115:Bmper APN 9 23399689 intron probably benign
IGL01978:Bmper APN 9 23381441 missense probably damaging 1.00
IGL02950:Bmper APN 9 23399494 missense probably damaging 1.00
IGL03193:Bmper APN 9 23366248 missense possibly damaging 0.46
PIT4531001:Bmper UTSW 9 23224817 missense possibly damaging 0.90
R0047:Bmper UTSW 9 23406686 missense probably damaging 1.00
R0047:Bmper UTSW 9 23406686 missense probably damaging 1.00
R0173:Bmper UTSW 9 23224829 missense probably benign 0.02
R0504:Bmper UTSW 9 23406687 missense probably damaging 1.00
R0550:Bmper UTSW 9 23373885 missense probably benign 0.01
R0722:Bmper UTSW 9 23373928 missense probably benign 0.00
R2254:Bmper UTSW 9 23381463 missense possibly damaging 0.81
R2255:Bmper UTSW 9 23381463 missense possibly damaging 0.81
R2863:Bmper UTSW 9 23483941 missense probably benign
R2865:Bmper UTSW 9 23483941 missense probably benign
R3841:Bmper UTSW 9 23473431 splice site probably null
R4056:Bmper UTSW 9 23399629 missense probably benign
R4105:Bmper UTSW 9 23224763 missense probably benign 0.00
R4108:Bmper UTSW 9 23224763 missense probably benign 0.00
R4352:Bmper UTSW 9 23483952 missense probably benign
R4824:Bmper UTSW 9 23223660 missense possibly damaging 0.77
R4909:Bmper UTSW 9 23377725 missense probably benign 0.07
R5356:Bmper UTSW 9 23373861 missense probably benign 0.01
R5379:Bmper UTSW 9 23297224 missense probably benign 0.42
R5666:Bmper UTSW 9 23473463 missense probably damaging 1.00
R5670:Bmper UTSW 9 23473463 missense probably damaging 1.00
R5883:Bmper UTSW 9 23406674 missense probably benign 0.28
R5963:Bmper UTSW 9 23375593 missense probably benign 0.03
R6312:Bmper UTSW 9 23406791 missense possibly damaging 0.46
R6768:Bmper UTSW 9 23381453 missense probably damaging 1.00
R6897:Bmper UTSW 9 23373929 missense probably benign 0.01
R6907:Bmper UTSW 9 23399572 missense probably damaging 1.00
R7220:Bmper UTSW 9 23399355 missense probably damaging 1.00
R7366:Bmper UTSW 9 23484004 missense probably damaging 1.00
R7473:Bmper UTSW 9 23375630 missense probably benign 0.00
R7483:Bmper UTSW 9 23483942 missense probably benign 0.04
R7686:Bmper UTSW 9 23399544 missense probably benign 0.00
R7976:Bmper UTSW 9 23406810 missense probably damaging 1.00
R8345:Bmper UTSW 9 23224830 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTAGACAGTGGCAAGGGTTG -3'
(R):5'- ACTTGAGTTTCTGGCATTCTCG -3'

Sequencing Primer
(F):5'- AATCTGGAGTGGGTGATC -3'
(R):5'- TCACTGTGCCTTGACAGAG -3'
Posted On2019-06-07