Incidental Mutation 'PIT4469001:Hint1'
ID555832
Institutional Source Beutler Lab
Gene Symbol Hint1
Ensembl Gene ENSMUSG00000020267
Gene Namehistidine triad nucleotide binding protein 1
SynonymsIpk1, PKCI-1, PKC inhibitor/ interacting protein, protein kinase C inhibitor 1, PRKCNH1
Accession Numbers
Is this an essential gene? Not available question?
Stock #PIT4469001 (G1)
Quality Score206.009
Status Not validated
Chromosome11
Chromosomal Location54866383-54870501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 54870070 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 112 (S112T)
Ref Sequence ENSEMBL: ENSMUSP00000114037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020504] [ENSMUST00000117710]
Predicted Effect probably benign
Transcript: ENSMUST00000020504
SMART Domains Protein: ENSMUSP00000020504
Gene: ENSMUSG00000020267

DomainStartEndE-ValueType
Pfam:DcpS_C 16 123 3.9e-29 PFAM
Pfam:HIT 24 121 7.3e-34 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000117710
AA Change: S112T
SMART Domains Protein: ENSMUSP00000114037
Gene: ENSMUSG00000020267
AA Change: S112T

DomainStartEndE-ValueType
Pfam:DcpS_C 16 78 7.6e-16 PFAM
Pfam:HIT 24 84 4.7e-17 PFAM
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.7%
  • 10x: 84.4%
  • 20x: 71.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that hydrolyzes purine nucleotide phosphoramidates substrates, including AMP-morpholidate, AMP-N-alanine methyl ester, AMP-alpha-acetyl lysine methyl ester, and AMP-NH2. The encoded protein interacts with these substrates via a histidine triad motif. This gene is considered a tumor suppressor gene. In addition, mutations in this gene can cause autosomal recessive neuromyotonia and axonal neuropathy. There are several related pseudogenes on chromosome 7. Several transcript variants have been observed. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant animals do not exhibit an overt phenotype, though one line of mutant mice was shown to be more susceptible to carcinogen-induced tumors than wild-type. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030408B16Rik T C 15: 101,293,271 V6A probably benign Het
A630001G21Rik A G 1: 85,725,199 F83L probably benign Het
Acsm2 T A 7: 119,578,185 C308S possibly damaging Het
Ak3 A G 19: 29,047,757 S25P probably damaging Het
Atp13a2 T A 4: 140,994,127 V176E unknown Het
Bmper A T 9: 23,406,549 H488L probably benign Het
Cacna1c A T 6: 118,595,972 C2084S unknown Het
Ccp110 T A 7: 118,722,377 N418K probably benign Het
Ddx17 C A 15: 79,543,813 G32C probably damaging Het
Dusp16 G A 6: 134,761,152 probably benign Het
Efl1 T G 7: 82,658,165 F90V probably benign Het
Ell2 T A 13: 75,761,892 N252K probably damaging Het
Gdf6 T C 4: 9,859,569 V217A probably damaging Het
Gm6205 T A 5: 94,682,793 V50E probably damaging Het
Hist1h1e A T 13: 23,622,379 V40E probably damaging Het
Kif5c T C 2: 49,741,348 V679A probably benign Het
Lrrn3 A T 12: 41,453,018 D433E probably benign Het
Mast4 G A 13: 102,804,718 T277M probably damaging Het
Naa11 A G 5: 97,391,626 probably null Het
Pcdh18 T A 3: 49,755,069 H599L probably benign Het
Pgc A T 17: 47,728,755 K25* probably null Het
Psd4 G A 2: 24,394,294 D57N probably benign Het
Pxdn G A 12: 30,005,829 R1238Q probably benign Het
Spata32 T C 11: 103,209,827 N38S probably benign Het
St5 G A 7: 109,531,130 A888V probably damaging Het
Tpr A G 1: 150,403,956 T279A probably benign Het
Unc13a C A 8: 71,658,314 E418* probably null Het
Vmn2r97 C A 17: 18,929,616 T422K probably benign Het
Zfp474 A T 18: 52,638,719 Q148L possibly damaging Het
Other mutations in Hint1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02621:Hint1 APN 11 54870185 utr 3 prime probably benign
R6312:Hint1 UTSW 11 54869990 missense probably benign 0.10
R8391:Hint1 UTSW 11 54866542 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GTGCCTCCCATTCAAACTGC -3'
(R):5'- CCCAGATCTGCAGCACATTTC -3'

Sequencing Primer
(F):5'- CTTTCTGGTGATACCCAAGAAGC -3'
(R):5'- GCAGCACATTTCTTGCCAAC -3'
Posted On2019-06-07