Incidental Mutation 'PIT4469001:Spata32'
ID555833
Institutional Source Beutler Lab
Gene Symbol Spata32
Ensembl Gene ENSMUSG00000044787
Gene Namespermatogenesis associated 32
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #PIT4469001 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location103208127-103218432 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103209827 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 38 (N38S)
Ref Sequence ENSEMBL: ENSMUSP00000099365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021323] [ENSMUST00000103076] [ENSMUST00000107026] [ENSMUST00000172850] [ENSMUST00000174567]
Predicted Effect probably benign
Transcript: ENSMUST00000021323
SMART Domains Protein: ENSMUSP00000021323
Gene: ENSMUSG00000020940

DomainStartEndE-ValueType
EFh 109 137 7.23e1 SMART
EFh 145 173 6.68e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103076
AA Change: N38S

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099365
Gene: ENSMUSG00000044787
AA Change: N38S

DomainStartEndE-ValueType
low complexity region 25 48 N/A INTRINSIC
Pfam:VAD1-2 106 332 3e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107026
SMART Domains Protein: ENSMUSP00000102641
Gene: ENSMUSG00000020940

DomainStartEndE-ValueType
EFh 40 68 7.23e1 SMART
EFh 76 104 6.68e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172850
SMART Domains Protein: ENSMUSP00000139837
Gene: ENSMUSG00000020940

DomainStartEndE-ValueType
EFh 109 137 3.5e-1 SMART
EFh 145 173 3.2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174567
SMART Domains Protein: ENSMUSP00000134292
Gene: ENSMUSG00000020940

DomainStartEndE-ValueType
SCOP:d1mr8a_ 153 209 5e-8 SMART
Blast:EFh 159 187 4e-12 BLAST
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.7%
  • 10x: 84.4%
  • 20x: 71.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030408B16Rik T C 15: 101,293,271 V6A probably benign Het
A630001G21Rik A G 1: 85,725,199 F83L probably benign Het
Acsm2 T A 7: 119,578,185 C308S possibly damaging Het
Ak3 A G 19: 29,047,757 S25P probably damaging Het
Atp13a2 T A 4: 140,994,127 V176E unknown Het
Bmper A T 9: 23,406,549 H488L probably benign Het
Cacna1c A T 6: 118,595,972 C2084S unknown Het
Ccp110 T A 7: 118,722,377 N418K probably benign Het
Ddx17 C A 15: 79,543,813 G32C probably damaging Het
Dusp16 G A 6: 134,761,152 probably benign Het
Efl1 T G 7: 82,658,165 F90V probably benign Het
Ell2 T A 13: 75,761,892 N252K probably damaging Het
Gdf6 T C 4: 9,859,569 V217A probably damaging Het
Gm6205 T A 5: 94,682,793 V50E probably damaging Het
Hint1 T A 11: 54,870,070 S112T unknown Het
Hist1h1e A T 13: 23,622,379 V40E probably damaging Het
Kif5c T C 2: 49,741,348 V679A probably benign Het
Lrrn3 A T 12: 41,453,018 D433E probably benign Het
Mast4 G A 13: 102,804,718 T277M probably damaging Het
Naa11 A G 5: 97,391,626 probably null Het
Pcdh18 T A 3: 49,755,069 H599L probably benign Het
Pgc A T 17: 47,728,755 K25* probably null Het
Psd4 G A 2: 24,394,294 D57N probably benign Het
Pxdn G A 12: 30,005,829 R1238Q probably benign Het
St5 G A 7: 109,531,130 A888V probably damaging Het
Tpr A G 1: 150,403,956 T279A probably benign Het
Unc13a C A 8: 71,658,314 E418* probably null Het
Vmn2r97 C A 17: 18,929,616 T422K probably benign Het
Zfp474 A T 18: 52,638,719 Q148L possibly damaging Het
Other mutations in Spata32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02422:Spata32 APN 11 103208880 missense probably benign 0.38
IGL02712:Spata32 APN 11 103208147 intron probably benign
IGL02966:Spata32 APN 11 103208803 missense possibly damaging 0.89
IGL03178:Spata32 APN 11 103210762 missense probably benign
R0245:Spata32 UTSW 11 103209095 missense probably damaging 0.99
R0454:Spata32 UTSW 11 103209299 missense probably damaging 1.00
R1773:Spata32 UTSW 11 103208818 missense probably damaging 1.00
R1881:Spata32 UTSW 11 103210735 unclassified probably benign
R3545:Spata32 UTSW 11 103210744 missense possibly damaging 0.67
R5485:Spata32 UTSW 11 103209296 missense probably damaging 0.96
R5576:Spata32 UTSW 11 103209827 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TAGCTCTGGGTCCACTTTGG -3'
(R):5'- TGCTCCAGGGTTCTTAATGG -3'

Sequencing Primer
(F):5'- GGTAACTCTGCTTCTACCTGAAAGG -3'
(R):5'- TGGAACAGAGGCAGTGGG -3'
Posted On2019-06-07