Incidental Mutation 'PIT4469001:Lrrn3'
ID 555835
Institutional Source Beutler Lab
Gene Symbol Lrrn3
Ensembl Gene ENSMUSG00000036295
Gene Name leucine rich repeat protein 3, neuronal
Synonyms NLRR-3
Accession Numbers
Essential gene? Probably non essential (E-score: 0.120) question?
Stock # PIT4469001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 41501667-41536056 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 41503017 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 433 (D433E)
Ref Sequence ENSEMBL: ENSMUSP00000043818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043884] [ENSMUST00000132121] [ENSMUST00000134965]
AlphaFold Q8CBC6
Predicted Effect probably benign
Transcript: ENSMUST00000043884
AA Change: D433E

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000043818
Gene: ENSMUSG00000036295
AA Change: D433E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
LRRNT 28 73 9.17e-4 SMART
LRR 115 138 2.63e0 SMART
LRR_TYP 139 162 1.5e-4 SMART
LRR 163 186 7.55e-1 SMART
LRR 187 210 1.76e1 SMART
LRR 211 234 1.62e1 SMART
LRR 235 258 5.11e0 SMART
LRR 260 282 3.18e1 SMART
LRR 333 356 4.44e0 SMART
LRRCT 368 420 3.7e-5 SMART
IGc2 435 503 5.04e-9 SMART
FN3 521 602 3.49e0 SMART
transmembrane domain 626 648 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132121
SMART Domains Protein: ENSMUSP00000118779
Gene: ENSMUSG00000056899

DomainStartEndE-ValueType
Pfam:Peptidase_S24 38 115 7.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134965
SMART Domains Protein: ENSMUSP00000116441
Gene: ENSMUSG00000056899

DomainStartEndE-ValueType
Pfam:Peptidase_S24 38 114 6.4e-11 PFAM
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.7%
  • 10x: 84.4%
  • 20x: 71.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutant mice exhibited increased mean percent body fat and male homozygous mutant mice exhibited enhanced glucose tolerance when compared with controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik A G 1: 85,652,920 (GRCm39) F83L probably benign Het
Acsm2 T A 7: 119,177,408 (GRCm39) C308S possibly damaging Het
Ak3 A G 19: 29,025,157 (GRCm39) S25P probably damaging Het
Atp13a2 T A 4: 140,721,438 (GRCm39) V176E unknown Het
Bmper A T 9: 23,317,845 (GRCm39) H488L probably benign Het
Cacna1c A T 6: 118,572,933 (GRCm39) C2084S unknown Het
Ccp110 T A 7: 118,321,600 (GRCm39) N418K probably benign Het
Ddx17 C A 15: 79,428,014 (GRCm39) G32C probably damaging Het
Dennd2b G A 7: 109,130,337 (GRCm39) A888V probably damaging Het
Dusp16 G A 6: 134,738,115 (GRCm39) probably benign Het
Efl1 T G 7: 82,307,373 (GRCm39) F90V probably benign Het
Ell2 T A 13: 75,910,011 (GRCm39) N252K probably damaging Het
Gdf6 T C 4: 9,859,569 (GRCm39) V217A probably damaging Het
H1f4 A T 13: 23,806,362 (GRCm39) V40E probably damaging Het
Hint1 T A 11: 54,760,896 (GRCm39) S112T unknown Het
Kif5c T C 2: 49,631,360 (GRCm39) V679A probably benign Het
Mast4 G A 13: 102,941,226 (GRCm39) T277M probably damaging Het
Naa11 A G 5: 97,539,485 (GRCm39) probably null Het
Pcdh18 T A 3: 49,709,518 (GRCm39) H599L probably benign Het
Pgc A T 17: 48,039,680 (GRCm39) K25* probably null Het
Pramel58 T A 5: 94,830,652 (GRCm39) V50E probably damaging Het
Psd4 G A 2: 24,284,306 (GRCm39) D57N probably benign Het
Pxdn G A 12: 30,055,828 (GRCm39) R1238Q probably benign Het
Smim41 T C 15: 101,191,152 (GRCm39) V6A probably benign Het
Spata32 T C 11: 103,100,653 (GRCm39) N38S probably benign Het
Tpr A G 1: 150,279,707 (GRCm39) T279A probably benign Het
Unc13a C A 8: 72,110,958 (GRCm39) E418* probably null Het
Vmn2r97 C A 17: 19,149,878 (GRCm39) T422K probably benign Het
Zfp474 A T 18: 52,771,791 (GRCm39) Q148L possibly damaging Het
Other mutations in Lrrn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Lrrn3 APN 12 41,502,191 (GRCm39) intron probably benign
IGL02825:Lrrn3 APN 12 41,502,592 (GRCm39) missense probably damaging 1.00
IGL02927:Lrrn3 APN 12 41,503,343 (GRCm39) missense probably damaging 1.00
IGL02970:Lrrn3 APN 12 41,502,359 (GRCm39) missense probably benign
IGL02995:Lrrn3 APN 12 41,502,216 (GRCm39) missense probably damaging 1.00
IGL02999:Lrrn3 APN 12 41,502,750 (GRCm39) missense probably benign 0.01
IGL03182:Lrrn3 APN 12 41,504,020 (GRCm39) missense probably damaging 1.00
IGL03280:Lrrn3 APN 12 41,504,146 (GRCm39) missense probably damaging 0.97
R0167:Lrrn3 UTSW 12 41,504,014 (GRCm39) missense probably damaging 1.00
R0414:Lrrn3 UTSW 12 41,503,939 (GRCm39) missense probably damaging 1.00
R0787:Lrrn3 UTSW 12 41,504,230 (GRCm39) missense probably damaging 1.00
R0894:Lrrn3 UTSW 12 41,504,033 (GRCm39) missense probably damaging 1.00
R1433:Lrrn3 UTSW 12 41,502,583 (GRCm39) missense possibly damaging 0.74
R1610:Lrrn3 UTSW 12 41,502,992 (GRCm39) missense possibly damaging 0.89
R1834:Lrrn3 UTSW 12 41,503,517 (GRCm39) missense probably damaging 1.00
R2068:Lrrn3 UTSW 12 41,502,995 (GRCm39) missense probably damaging 1.00
R2871:Lrrn3 UTSW 12 41,502,722 (GRCm39) missense probably benign 0.00
R2871:Lrrn3 UTSW 12 41,502,722 (GRCm39) missense probably benign 0.00
R3771:Lrrn3 UTSW 12 41,502,869 (GRCm39) missense probably damaging 1.00
R4408:Lrrn3 UTSW 12 41,504,041 (GRCm39) missense probably benign 0.04
R4410:Lrrn3 UTSW 12 41,502,583 (GRCm39) missense possibly damaging 0.74
R4684:Lrrn3 UTSW 12 41,504,243 (GRCm39) missense possibly damaging 0.75
R4770:Lrrn3 UTSW 12 41,502,442 (GRCm39) missense probably benign 0.08
R4927:Lrrn3 UTSW 12 41,503,124 (GRCm39) missense probably damaging 1.00
R5037:Lrrn3 UTSW 12 41,503,594 (GRCm39) missense probably damaging 1.00
R5482:Lrrn3 UTSW 12 41,502,387 (GRCm39) missense probably damaging 0.96
R5482:Lrrn3 UTSW 12 41,502,386 (GRCm39) missense probably benign 0.01
R5667:Lrrn3 UTSW 12 41,502,297 (GRCm39) missense possibly damaging 0.77
R6022:Lrrn3 UTSW 12 41,503,429 (GRCm39) missense probably damaging 0.96
R6087:Lrrn3 UTSW 12 41,503,534 (GRCm39) missense possibly damaging 0.84
R6129:Lrrn3 UTSW 12 41,503,787 (GRCm39) nonsense probably null
R6309:Lrrn3 UTSW 12 41,503,205 (GRCm39) missense probably damaging 1.00
R7449:Lrrn3 UTSW 12 41,503,487 (GRCm39) missense probably damaging 1.00
R7555:Lrrn3 UTSW 12 41,502,910 (GRCm39) missense probably benign 0.01
R7560:Lrrn3 UTSW 12 41,502,712 (GRCm39) missense possibly damaging 0.93
R8059:Lrrn3 UTSW 12 41,504,216 (GRCm39) missense probably benign 0.22
R8134:Lrrn3 UTSW 12 41,503,047 (GRCm39) missense probably damaging 1.00
R8798:Lrrn3 UTSW 12 41,503,174 (GRCm39) missense possibly damaging 0.61
R9308:Lrrn3 UTSW 12 41,503,945 (GRCm39) missense probably damaging 1.00
R9318:Lrrn3 UTSW 12 41,503,243 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGTTGCTATGCAGGTGTACAAC -3'
(R):5'- TAGCAATCCCATCCGTTGCG -3'

Sequencing Primer
(F):5'- CTCTAGTGTGCCTTCAGAAT -3'
(R):5'- TGCGACTGTGTAATCCGC -3'
Posted On 2019-06-07