Incidental Mutation 'PIT4469001:H1f4'
ID 555836
Institutional Source Beutler Lab
Gene Symbol H1f4
Ensembl Gene ENSMUSG00000051627
Gene Name H1.4 linker histone, cluster member
Synonyms H1f4, H1-4, H1e, H1var2, Hist1h1e, H1s-4
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # PIT4469001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 23805760-23806541 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 23806362 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 40 (V40E)
Ref Sequence ENSEMBL: ENSMUSP00000057308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051091] [ENSMUST00000062045] [ENSMUST00000091704]
AlphaFold P43274
Predicted Effect probably benign
Transcript: ENSMUST00000051091
SMART Domains Protein: ENSMUSP00000061247
Gene: ENSMUSG00000047246

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 1.43e-72 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000062045
AA Change: V40E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057308
Gene: ENSMUSG00000051627
AA Change: V40E

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
H15 34 99 7.5e-23 SMART
low complexity region 116 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091704
SMART Domains Protein: ENSMUSP00000089296
Gene: ENSMUSG00000047246

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 1.43e-72 SMART
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.7%
  • 10x: 84.4%
  • 20x: 71.1%
Validation Efficiency
MGI Phenotype FUNCTION: Histones are basic nuclear proteins responsible for nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H1 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for targeted null mutations are normal, but Hist1h1e/Hist1h1c double knockout males are significantly smaller than normal. The Hist1h1e/Hist1h1d/Hist1h1e triple knockout is lethal by embryonic day 12.5, and heterozygotes are underrepresented. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik A G 1: 85,652,920 (GRCm39) F83L probably benign Het
Acsm2 T A 7: 119,177,408 (GRCm39) C308S possibly damaging Het
Ak3 A G 19: 29,025,157 (GRCm39) S25P probably damaging Het
Atp13a2 T A 4: 140,721,438 (GRCm39) V176E unknown Het
Bmper A T 9: 23,317,845 (GRCm39) H488L probably benign Het
Cacna1c A T 6: 118,572,933 (GRCm39) C2084S unknown Het
Ccp110 T A 7: 118,321,600 (GRCm39) N418K probably benign Het
Ddx17 C A 15: 79,428,014 (GRCm39) G32C probably damaging Het
Dennd2b G A 7: 109,130,337 (GRCm39) A888V probably damaging Het
Dusp16 G A 6: 134,738,115 (GRCm39) probably benign Het
Efl1 T G 7: 82,307,373 (GRCm39) F90V probably benign Het
Ell2 T A 13: 75,910,011 (GRCm39) N252K probably damaging Het
Gdf6 T C 4: 9,859,569 (GRCm39) V217A probably damaging Het
Hint1 T A 11: 54,760,896 (GRCm39) S112T unknown Het
Kif5c T C 2: 49,631,360 (GRCm39) V679A probably benign Het
Lrrn3 A T 12: 41,503,017 (GRCm39) D433E probably benign Het
Mast4 G A 13: 102,941,226 (GRCm39) T277M probably damaging Het
Naa11 A G 5: 97,539,485 (GRCm39) probably null Het
Pcdh18 T A 3: 49,709,518 (GRCm39) H599L probably benign Het
Pgc A T 17: 48,039,680 (GRCm39) K25* probably null Het
Pramel58 T A 5: 94,830,652 (GRCm39) V50E probably damaging Het
Psd4 G A 2: 24,284,306 (GRCm39) D57N probably benign Het
Pxdn G A 12: 30,055,828 (GRCm39) R1238Q probably benign Het
Smim41 T C 15: 101,191,152 (GRCm39) V6A probably benign Het
Spata32 T C 11: 103,100,653 (GRCm39) N38S probably benign Het
Tpr A G 1: 150,279,707 (GRCm39) T279A probably benign Het
Unc13a C A 8: 72,110,958 (GRCm39) E418* probably null Het
Vmn2r97 C A 17: 19,149,878 (GRCm39) T422K probably benign Het
Zfp474 A T 18: 52,771,791 (GRCm39) Q148L possibly damaging Het
Other mutations in H1f4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:H1f4 APN 13 23,806,005 (GRCm39) unclassified probably benign
IGL03354:H1f4 APN 13 23,806,060 (GRCm39) unclassified probably benign
R2339:H1f4 UTSW 13 23,805,943 (GRCm39) unclassified probably benign
R3110:H1f4 UTSW 13 23,805,829 (GRCm39) unclassified probably benign
R3112:H1f4 UTSW 13 23,805,829 (GRCm39) unclassified probably benign
R3757:H1f4 UTSW 13 23,806,240 (GRCm39) nonsense probably null
R3758:H1f4 UTSW 13 23,806,240 (GRCm39) nonsense probably null
R5116:H1f4 UTSW 13 23,806,270 (GRCm39) missense probably damaging 1.00
R6034:H1f4 UTSW 13 23,806,296 (GRCm39) missense probably damaging 1.00
R6034:H1f4 UTSW 13 23,806,296 (GRCm39) missense probably damaging 1.00
R7008:H1f4 UTSW 13 23,806,192 (GRCm39) missense probably damaging 1.00
R7051:H1f4 UTSW 13 23,806,422 (GRCm39) missense probably benign 0.00
R7317:H1f4 UTSW 13 23,806,350 (GRCm39) missense probably damaging 1.00
R8220:H1f4 UTSW 13 23,805,922 (GRCm39) missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- GAAGCCGCCTTCTTGTTGAG -3'
(R):5'- TCCGCCCTATATAAACGGGC -3'

Sequencing Primer
(F):5'- CCGCCTTCTTGTTGAGTTTGAAG -3'
(R):5'- CCTATATAAACGGGCGGGCG -3'
Posted On 2019-06-07