Incidental Mutation 'PIT4469001:Hist1h1e'
ID555836
Institutional Source Beutler Lab
Gene Symbol Hist1h1e
Ensembl Gene ENSMUSG00000051627
Gene Namehistone cluster 1, H1e
SynonymsH1-4, H1var2, H1s-4, H1f4, H1e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4469001 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location23620629-23622558 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23622379 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 40 (V40E)
Ref Sequence ENSEMBL: ENSMUSP00000057308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051091] [ENSMUST00000062045] [ENSMUST00000091704]
Predicted Effect probably benign
Transcript: ENSMUST00000051091
SMART Domains Protein: ENSMUSP00000061247
Gene: ENSMUSG00000047246

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 1.43e-72 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000062045
AA Change: V40E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057308
Gene: ENSMUSG00000051627
AA Change: V40E

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
H15 34 99 7.5e-23 SMART
low complexity region 116 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091704
SMART Domains Protein: ENSMUSP00000089296
Gene: ENSMUSG00000047246

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 1.43e-72 SMART
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.7%
  • 10x: 84.4%
  • 20x: 71.1%
Validation Efficiency
MGI Phenotype FUNCTION: Histones are basic nuclear proteins responsible for nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H1 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for targeted null mutations are normal, but Hist1h1e/Hist1h1c double knockout males are significantly smaller than normal. The Hist1h1e/Hist1h1d/Hist1h1e triple knockout is lethal by embryonic day 12.5, and heterozygotes are underrepresented. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030408B16Rik T C 15: 101,293,271 V6A probably benign Het
A630001G21Rik A G 1: 85,725,199 F83L probably benign Het
Acsm2 T A 7: 119,578,185 C308S possibly damaging Het
Ak3 A G 19: 29,047,757 S25P probably damaging Het
Atp13a2 T A 4: 140,994,127 V176E unknown Het
Bmper A T 9: 23,406,549 H488L probably benign Het
Cacna1c A T 6: 118,595,972 C2084S unknown Het
Ccp110 T A 7: 118,722,377 N418K probably benign Het
Ddx17 C A 15: 79,543,813 G32C probably damaging Het
Dusp16 G A 6: 134,761,152 probably benign Het
Efl1 T G 7: 82,658,165 F90V probably benign Het
Ell2 T A 13: 75,761,892 N252K probably damaging Het
Gdf6 T C 4: 9,859,569 V217A probably damaging Het
Gm6205 T A 5: 94,682,793 V50E probably damaging Het
Hint1 T A 11: 54,870,070 S112T unknown Het
Kif5c T C 2: 49,741,348 V679A probably benign Het
Lrrn3 A T 12: 41,453,018 D433E probably benign Het
Mast4 G A 13: 102,804,718 T277M probably damaging Het
Naa11 A G 5: 97,391,626 probably null Het
Pcdh18 T A 3: 49,755,069 H599L probably benign Het
Pgc A T 17: 47,728,755 K25* probably null Het
Psd4 G A 2: 24,394,294 D57N probably benign Het
Pxdn G A 12: 30,005,829 R1238Q probably benign Het
Spata32 T C 11: 103,209,827 N38S probably benign Het
St5 G A 7: 109,531,130 A888V probably damaging Het
Tpr A G 1: 150,403,956 T279A probably benign Het
Unc13a C A 8: 71,658,314 E418* probably null Het
Vmn2r97 C A 17: 18,929,616 T422K probably benign Het
Zfp474 A T 18: 52,638,719 Q148L possibly damaging Het
Other mutations in Hist1h1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Hist1h1e APN 13 23622022 unclassified probably benign
IGL03354:Hist1h1e APN 13 23622077 unclassified probably benign
R2339:Hist1h1e UTSW 13 23621960 unclassified probably benign
R3110:Hist1h1e UTSW 13 23621846 unclassified probably benign
R3112:Hist1h1e UTSW 13 23621846 unclassified probably benign
R3757:Hist1h1e UTSW 13 23622257 nonsense probably null
R3758:Hist1h1e UTSW 13 23622257 nonsense probably null
R5116:Hist1h1e UTSW 13 23622287 missense probably damaging 1.00
R6034:Hist1h1e UTSW 13 23622313 missense probably damaging 1.00
R6034:Hist1h1e UTSW 13 23622313 missense probably damaging 1.00
R7008:Hist1h1e UTSW 13 23622209 missense probably damaging 1.00
R7051:Hist1h1e UTSW 13 23622439 missense probably benign 0.00
R7317:Hist1h1e UTSW 13 23622367 missense probably damaging 1.00
R8220:Hist1h1e UTSW 13 23621939 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- GAAGCCGCCTTCTTGTTGAG -3'
(R):5'- TCCGCCCTATATAAACGGGC -3'

Sequencing Primer
(F):5'- CCGCCTTCTTGTTGAGTTTGAAG -3'
(R):5'- CCTATATAAACGGGCGGGCG -3'
Posted On2019-06-07