Incidental Mutation 'PIT4469001:Ell2'
ID555837
Institutional Source Beutler Lab
Gene Symbol Ell2
Ensembl Gene ENSMUSG00000001542
Gene Nameelongation factor RNA polymerase II 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4469001 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location75706757-75772364 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75761892 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 252 (N252K)
Ref Sequence ENSEMBL: ENSMUSP00000001583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001583] [ENSMUST00000220572] [ENSMUST00000222194] [ENSMUST00000222853]
Predicted Effect probably damaging
Transcript: ENSMUST00000001583
AA Change: N252K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000001583
Gene: ENSMUSG00000001542
AA Change: N252K

DomainStartEndE-ValueType
Pfam:ELL 11 291 2.4e-108 PFAM
low complexity region 362 401 N/A INTRINSIC
low complexity region 451 476 N/A INTRINSIC
Pfam:Occludin_ELL 531 632 2e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220572
Predicted Effect probably benign
Transcript: ENSMUST00000222194
Predicted Effect probably damaging
Transcript: ENSMUST00000222853
AA Change: N120K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.7%
  • 10x: 84.4%
  • 20x: 71.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030408B16Rik T C 15: 101,293,271 V6A probably benign Het
A630001G21Rik A G 1: 85,725,199 F83L probably benign Het
Acsm2 T A 7: 119,578,185 C308S possibly damaging Het
Ak3 A G 19: 29,047,757 S25P probably damaging Het
Atp13a2 T A 4: 140,994,127 V176E unknown Het
Bmper A T 9: 23,406,549 H488L probably benign Het
Cacna1c A T 6: 118,595,972 C2084S unknown Het
Ccp110 T A 7: 118,722,377 N418K probably benign Het
Ddx17 C A 15: 79,543,813 G32C probably damaging Het
Dusp16 G A 6: 134,761,152 probably benign Het
Efl1 T G 7: 82,658,165 F90V probably benign Het
Gdf6 T C 4: 9,859,569 V217A probably damaging Het
Gm6205 T A 5: 94,682,793 V50E probably damaging Het
Hint1 T A 11: 54,870,070 S112T unknown Het
Hist1h1e A T 13: 23,622,379 V40E probably damaging Het
Kif5c T C 2: 49,741,348 V679A probably benign Het
Lrrn3 A T 12: 41,453,018 D433E probably benign Het
Mast4 G A 13: 102,804,718 T277M probably damaging Het
Naa11 A G 5: 97,391,626 probably null Het
Pcdh18 T A 3: 49,755,069 H599L probably benign Het
Pgc A T 17: 47,728,755 K25* probably null Het
Psd4 G A 2: 24,394,294 D57N probably benign Het
Pxdn G A 12: 30,005,829 R1238Q probably benign Het
Spata32 T C 11: 103,209,827 N38S probably benign Het
St5 G A 7: 109,531,130 A888V probably damaging Het
Tpr A G 1: 150,403,956 T279A probably benign Het
Unc13a C A 8: 71,658,314 E418* probably null Het
Vmn2r97 C A 17: 18,929,616 T422K probably benign Het
Zfp474 A T 18: 52,638,719 Q148L possibly damaging Het
Other mutations in Ell2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Ell2 APN 13 75756290 missense probably damaging 1.00
IGL01315:Ell2 APN 13 75762232 unclassified probably benign
IGL01446:Ell2 APN 13 75761991 missense probably benign 0.02
IGL02691:Ell2 APN 13 75756486 missense probably damaging 0.97
IGL02963:Ell2 APN 13 75769643 missense possibly damaging 0.48
IGL03035:Ell2 APN 13 75763648 nonsense probably null
R0123:Ell2 UTSW 13 75762140 splice site probably benign
R0321:Ell2 UTSW 13 75761888 missense probably damaging 1.00
R0594:Ell2 UTSW 13 75749993 missense probably damaging 1.00
R0892:Ell2 UTSW 13 75763639 missense probably damaging 0.97
R1078:Ell2 UTSW 13 75746419 splice site probably benign
R1696:Ell2 UTSW 13 75769558 missense probably damaging 1.00
R2325:Ell2 UTSW 13 75769626 missense probably damaging 1.00
R2886:Ell2 UTSW 13 75763785 missense probably damaging 1.00
R3760:Ell2 UTSW 13 75762162 missense probably benign 0.37
R4206:Ell2 UTSW 13 75761948 missense probably damaging 1.00
R4632:Ell2 UTSW 13 75769574 missense possibly damaging 0.84
R5068:Ell2 UTSW 13 75763618 missense probably benign 0.00
R6980:Ell2 UTSW 13 75756376 missense probably null
R6983:Ell2 UTSW 13 75761887 missense probably damaging 1.00
R6984:Ell2 UTSW 13 75761887 missense probably damaging 1.00
R6986:Ell2 UTSW 13 75761887 missense probably damaging 1.00
R7073:Ell2 UTSW 13 75761887 missense probably damaging 1.00
R7074:Ell2 UTSW 13 75761887 missense probably damaging 1.00
R7473:Ell2 UTSW 13 75750035 missense probably damaging 1.00
R7590:Ell2 UTSW 13 75770735 missense probably damaging 1.00
RF018:Ell2 UTSW 13 75763608 missense probably damaging 1.00
Z1088:Ell2 UTSW 13 75761873 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- AGGTAAACATATGAAGCAACCTGA -3'
(R):5'- CTCGTTTCCACCTCAACAGTCAA -3'

Sequencing Primer
(F):5'- CTTTATGCACACATGTAGCAGAGG -3'
(R):5'- GTCAAACAACACTTATTTGCACC -3'
Posted On2019-06-07