Incidental Mutation 'PIT4469001:Ddx17'
ID 555839
Institutional Source Beutler Lab
Gene Symbol Ddx17
Ensembl Gene ENSMUSG00000055065
Gene Name DEAD box helicase 17
Synonyms p72, LOC381024, 2610007K22Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 17, A430025E01Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # PIT4469001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 79411937-79430942 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 79428014 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Cysteine at position 32 (G32C)
Ref Sequence ENSEMBL: ENSMUSP00000055535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054014] [ENSMUST00000229431] [ENSMUST00000229877] [ENSMUST00000231053]
AlphaFold Q501J6
Predicted Effect probably damaging
Transcript: ENSMUST00000054014
AA Change: G32C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055535
Gene: ENSMUSG00000055065
AA Change: G32C

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Blast:DEXDc 29 87 7e-18 BLAST
DEXDc 111 314 4.79e-65 SMART
HELICc 353 434 3.34e-32 SMART
low complexity region 477 486 N/A INTRINSIC
low complexity region 550 576 N/A INTRINSIC
low complexity region 578 611 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000229431
AA Change: G32C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000229877
AA Change: G32C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000231053
AA Change: G32C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.7%
  • 10x: 84.4%
  • 20x: 71.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the mouse homolog of human DEAD box polypeptide 17. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD). RNA helicases of the DEAD-box family are involved in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and splicesosome assembly. Alternative splicing of this gene results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik A G 1: 85,652,920 (GRCm39) F83L probably benign Het
Acsm2 T A 7: 119,177,408 (GRCm39) C308S possibly damaging Het
Ak3 A G 19: 29,025,157 (GRCm39) S25P probably damaging Het
Atp13a2 T A 4: 140,721,438 (GRCm39) V176E unknown Het
Bmper A T 9: 23,317,845 (GRCm39) H488L probably benign Het
Cacna1c A T 6: 118,572,933 (GRCm39) C2084S unknown Het
Ccp110 T A 7: 118,321,600 (GRCm39) N418K probably benign Het
Dennd2b G A 7: 109,130,337 (GRCm39) A888V probably damaging Het
Dusp16 G A 6: 134,738,115 (GRCm39) probably benign Het
Efl1 T G 7: 82,307,373 (GRCm39) F90V probably benign Het
Ell2 T A 13: 75,910,011 (GRCm39) N252K probably damaging Het
Gdf6 T C 4: 9,859,569 (GRCm39) V217A probably damaging Het
H1f4 A T 13: 23,806,362 (GRCm39) V40E probably damaging Het
Hint1 T A 11: 54,760,896 (GRCm39) S112T unknown Het
Kif5c T C 2: 49,631,360 (GRCm39) V679A probably benign Het
Lrrn3 A T 12: 41,503,017 (GRCm39) D433E probably benign Het
Mast4 G A 13: 102,941,226 (GRCm39) T277M probably damaging Het
Naa11 A G 5: 97,539,485 (GRCm39) probably null Het
Pcdh18 T A 3: 49,709,518 (GRCm39) H599L probably benign Het
Pgc A T 17: 48,039,680 (GRCm39) K25* probably null Het
Pramel58 T A 5: 94,830,652 (GRCm39) V50E probably damaging Het
Psd4 G A 2: 24,284,306 (GRCm39) D57N probably benign Het
Pxdn G A 12: 30,055,828 (GRCm39) R1238Q probably benign Het
Smim41 T C 15: 101,191,152 (GRCm39) V6A probably benign Het
Spata32 T C 11: 103,100,653 (GRCm39) N38S probably benign Het
Tpr A G 1: 150,279,707 (GRCm39) T279A probably benign Het
Unc13a C A 8: 72,110,958 (GRCm39) E418* probably null Het
Vmn2r97 C A 17: 19,149,878 (GRCm39) T422K probably benign Het
Zfp474 A T 18: 52,771,791 (GRCm39) Q148L possibly damaging Het
Other mutations in Ddx17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02030:Ddx17 APN 15 79,414,577 (GRCm39) missense probably benign
IGL02904:Ddx17 APN 15 79,414,638 (GRCm39) nonsense probably null
R0437:Ddx17 UTSW 15 79,421,672 (GRCm39) missense probably damaging 1.00
R0507:Ddx17 UTSW 15 79,421,758 (GRCm39) splice site probably benign
R1160:Ddx17 UTSW 15 79,425,288 (GRCm39) missense probably damaging 1.00
R1456:Ddx17 UTSW 15 79,414,577 (GRCm39) missense probably benign
R1572:Ddx17 UTSW 15 79,422,766 (GRCm39) missense probably damaging 0.99
R4510:Ddx17 UTSW 15 79,422,793 (GRCm39) missense probably damaging 1.00
R4511:Ddx17 UTSW 15 79,422,793 (GRCm39) missense probably damaging 1.00
R4576:Ddx17 UTSW 15 79,425,347 (GRCm39) missense probably benign
R6955:Ddx17 UTSW 15 79,414,668 (GRCm39) missense probably benign 0.01
R7152:Ddx17 UTSW 15 79,414,464 (GRCm39) missense possibly damaging 0.53
R7320:Ddx17 UTSW 15 79,416,105 (GRCm39) missense probably damaging 1.00
R7805:Ddx17 UTSW 15 79,421,723 (GRCm39) missense probably damaging 1.00
R7901:Ddx17 UTSW 15 79,422,789 (GRCm39) missense probably damaging 1.00
R7976:Ddx17 UTSW 15 79,420,156 (GRCm39) critical splice donor site probably null
R8934:Ddx17 UTSW 15 79,420,217 (GRCm39) missense possibly damaging 0.58
Z1177:Ddx17 UTSW 15 79,414,373 (GRCm39) missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- AGCCTGGATCTACAGTGGAC -3'
(R):5'- GAGTACCACTTCTCTGCAAGAGC -3'

Sequencing Primer
(F):5'- TGGTCTACAAAGCGAGTTCC -3'
(R):5'- ATTGTATCCAGAATCTCTAGTGCC -3'
Posted On 2019-06-07