Incidental Mutation 'PIT4469001:Ddx17'
ID555839
Institutional Source Beutler Lab
Gene Symbol Ddx17
Ensembl Gene ENSMUSG00000055065
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 17
SynonymsA430025E01Rik, 2610007K22Rik, p72, LOC381024
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4469001 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location79527736-79546741 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 79543813 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 32 (G32C)
Ref Sequence ENSEMBL: ENSMUSP00000055535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054014] [ENSMUST00000229431] [ENSMUST00000229877] [ENSMUST00000231053]
Predicted Effect probably damaging
Transcript: ENSMUST00000054014
AA Change: G32C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055535
Gene: ENSMUSG00000055065
AA Change: G32C

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Blast:DEXDc 29 87 7e-18 BLAST
DEXDc 111 314 4.79e-65 SMART
HELICc 353 434 3.34e-32 SMART
low complexity region 477 486 N/A INTRINSIC
low complexity region 550 576 N/A INTRINSIC
low complexity region 578 611 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000229431
AA Change: G32C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000229877
AA Change: G32C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000231053
AA Change: G32C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.7%
  • 10x: 84.4%
  • 20x: 71.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the mouse homolog of human DEAD box polypeptide 17. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD). RNA helicases of the DEAD-box family are involved in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and splicesosome assembly. Alternative splicing of this gene results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030408B16Rik T C 15: 101,293,271 V6A probably benign Het
A630001G21Rik A G 1: 85,725,199 F83L probably benign Het
Acsm2 T A 7: 119,578,185 C308S possibly damaging Het
Ak3 A G 19: 29,047,757 S25P probably damaging Het
Atp13a2 T A 4: 140,994,127 V176E unknown Het
Bmper A T 9: 23,406,549 H488L probably benign Het
Cacna1c A T 6: 118,595,972 C2084S unknown Het
Ccp110 T A 7: 118,722,377 N418K probably benign Het
Dusp16 G A 6: 134,761,152 probably benign Het
Efl1 T G 7: 82,658,165 F90V probably benign Het
Ell2 T A 13: 75,761,892 N252K probably damaging Het
Gdf6 T C 4: 9,859,569 V217A probably damaging Het
Gm6205 T A 5: 94,682,793 V50E probably damaging Het
Hint1 T A 11: 54,870,070 S112T unknown Het
Hist1h1e A T 13: 23,622,379 V40E probably damaging Het
Kif5c T C 2: 49,741,348 V679A probably benign Het
Lrrn3 A T 12: 41,453,018 D433E probably benign Het
Mast4 G A 13: 102,804,718 T277M probably damaging Het
Naa11 A G 5: 97,391,626 probably null Het
Pcdh18 T A 3: 49,755,069 H599L probably benign Het
Pgc A T 17: 47,728,755 K25* probably null Het
Psd4 G A 2: 24,394,294 D57N probably benign Het
Pxdn G A 12: 30,005,829 R1238Q probably benign Het
Spata32 T C 11: 103,209,827 N38S probably benign Het
St5 G A 7: 109,531,130 A888V probably damaging Het
Tpr A G 1: 150,403,956 T279A probably benign Het
Unc13a C A 8: 71,658,314 E418* probably null Het
Vmn2r97 C A 17: 18,929,616 T422K probably benign Het
Zfp474 A T 18: 52,638,719 Q148L possibly damaging Het
Other mutations in Ddx17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02030:Ddx17 APN 15 79530376 missense probably benign
IGL02904:Ddx17 APN 15 79530437 nonsense probably null
R0437:Ddx17 UTSW 15 79537471 missense probably damaging 1.00
R0507:Ddx17 UTSW 15 79537557 splice site probably benign
R1160:Ddx17 UTSW 15 79541087 missense probably damaging 1.00
R1456:Ddx17 UTSW 15 79530376 missense probably benign
R1572:Ddx17 UTSW 15 79538565 missense probably damaging 0.99
R4510:Ddx17 UTSW 15 79538592 missense probably damaging 1.00
R4511:Ddx17 UTSW 15 79538592 missense probably damaging 1.00
R4576:Ddx17 UTSW 15 79541146 missense probably benign
R6955:Ddx17 UTSW 15 79530467 missense probably benign 0.01
R7152:Ddx17 UTSW 15 79530263 missense possibly damaging 0.53
R7320:Ddx17 UTSW 15 79531904 missense probably damaging 1.00
R7805:Ddx17 UTSW 15 79537522 missense probably damaging 1.00
R7901:Ddx17 UTSW 15 79538588 missense probably damaging 1.00
R7976:Ddx17 UTSW 15 79535955 critical splice donor site probably null
Z1177:Ddx17 UTSW 15 79530172 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- AGCCTGGATCTACAGTGGAC -3'
(R):5'- GAGTACCACTTCTCTGCAAGAGC -3'

Sequencing Primer
(F):5'- TGGTCTACAAAGCGAGTTCC -3'
(R):5'- ATTGTATCCAGAATCTCTAGTGCC -3'
Posted On2019-06-07