Incidental Mutation 'PIT4469001:6030408B16Rik'
ID555840
Institutional Source Beutler Lab
Gene Symbol 6030408B16Rik
Ensembl Gene ENSMUSG00000075408
Gene NameRIKEN cDNA 6030408B16 gene
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock #PIT4469001 (G1)
Quality Score132.008
Status Not validated
Chromosome15
Chromosomal Location101293212-101297426 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101293271 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 6 (V6A)
Ref Sequence ENSEMBL: ENSMUSP00000153762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048393] [ENSMUST00000071328] [ENSMUST00000191426] [ENSMUST00000230525]
Predicted Effect probably benign
Transcript: ENSMUST00000048393
SMART Domains Protein: ENSMUSP00000045474
Gene: ENSMUSG00000037204

DomainStartEndE-ValueType
Pfam:DUF1649 9 172 4.6e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000071328
AA Change: V6A

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000071291
Gene: ENSMUSG00000075408
AA Change: V6A

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000071328
AA Change: V6A

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000191426
AA Change: V6A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000230525
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.7%
  • 10x: 84.4%
  • 20x: 71.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik A G 1: 85,725,199 F83L probably benign Het
Acsm2 T A 7: 119,578,185 C308S possibly damaging Het
Ak3 A G 19: 29,047,757 S25P probably damaging Het
Atp13a2 T A 4: 140,994,127 V176E unknown Het
Bmper A T 9: 23,406,549 H488L probably benign Het
Cacna1c A T 6: 118,595,972 C2084S unknown Het
Ccp110 T A 7: 118,722,377 N418K probably benign Het
Ddx17 C A 15: 79,543,813 G32C probably damaging Het
Dusp16 G A 6: 134,761,152 probably benign Het
Efl1 T G 7: 82,658,165 F90V probably benign Het
Ell2 T A 13: 75,761,892 N252K probably damaging Het
Gdf6 T C 4: 9,859,569 V217A probably damaging Het
Gm6205 T A 5: 94,682,793 V50E probably damaging Het
Hint1 T A 11: 54,870,070 S112T unknown Het
Hist1h1e A T 13: 23,622,379 V40E probably damaging Het
Kif5c T C 2: 49,741,348 V679A probably benign Het
Lrrn3 A T 12: 41,453,018 D433E probably benign Het
Mast4 G A 13: 102,804,718 T277M probably damaging Het
Naa11 A G 5: 97,391,626 probably null Het
Pcdh18 T A 3: 49,755,069 H599L probably benign Het
Pgc A T 17: 47,728,755 K25* probably null Het
Psd4 G A 2: 24,394,294 D57N probably benign Het
Pxdn G A 12: 30,005,829 R1238Q probably benign Het
Spata32 T C 11: 103,209,827 N38S probably benign Het
St5 G A 7: 109,531,130 A888V probably damaging Het
Tpr A G 1: 150,403,956 T279A probably benign Het
Unc13a C A 8: 71,658,314 E418* probably null Het
Vmn2r97 C A 17: 18,929,616 T422K probably benign Het
Zfp474 A T 18: 52,638,719 Q148L possibly damaging Het
Predicted Primers PCR Primer
(F):5'- ATCCAGCCTGTCAGAGAAGGAC -3'
(R):5'- ACACCTAGGAGTCGTCATCC -3'

Sequencing Primer
(F):5'- CCTGTCAGAGAAGGACCTCGAG -3'
(R):5'- GAGTCGTCATCCCCTCCACAG -3'
Posted On2019-06-07