Incidental Mutation 'PIT4469001:Vmn2r97'
ID 555841
Institutional Source Beutler Lab
Gene Symbol Vmn2r97
Ensembl Gene ENSMUSG00000091491
Gene Name vomeronasal 2, receptor 97
Synonyms EG627367
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # PIT4469001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 18914300-18958087 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 18929616 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 422 (T422K)
Ref Sequence ENSEMBL: ENSMUSP00000129313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168710] [ENSMUST00000232219]
AlphaFold K7N6Z2
Predicted Effect probably benign
Transcript: ENSMUST00000168710
AA Change: T422K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000129313
Gene: ENSMUSG00000091491
AA Change: T422K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 82 442 2.9e-36 PFAM
Pfam:NCD3G 513 566 4.9e-21 PFAM
Pfam:7tm_3 599 834 1.7e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000232219
AA Change: T422K

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.7%
  • 10x: 84.4%
  • 20x: 71.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030408B16Rik T C 15: 101,293,271 V6A probably benign Het
A630001G21Rik A G 1: 85,725,199 F83L probably benign Het
Acsm2 T A 7: 119,578,185 C308S possibly damaging Het
Ak3 A G 19: 29,047,757 S25P probably damaging Het
Atp13a2 T A 4: 140,994,127 V176E unknown Het
Bmper A T 9: 23,406,549 H488L probably benign Het
Cacna1c A T 6: 118,595,972 C2084S unknown Het
Ccp110 T A 7: 118,722,377 N418K probably benign Het
Ddx17 C A 15: 79,543,813 G32C probably damaging Het
Dusp16 G A 6: 134,761,152 probably benign Het
Efl1 T G 7: 82,658,165 F90V probably benign Het
Ell2 T A 13: 75,761,892 N252K probably damaging Het
Gdf6 T C 4: 9,859,569 V217A probably damaging Het
Gm6205 T A 5: 94,682,793 V50E probably damaging Het
Hint1 T A 11: 54,870,070 S112T unknown Het
Hist1h1e A T 13: 23,622,379 V40E probably damaging Het
Kif5c T C 2: 49,741,348 V679A probably benign Het
Lrrn3 A T 12: 41,453,018 D433E probably benign Het
Mast4 G A 13: 102,804,718 T277M probably damaging Het
Naa11 A G 5: 97,391,626 probably null Het
Pcdh18 T A 3: 49,755,069 H599L probably benign Het
Pgc A T 17: 47,728,755 K25* probably null Het
Psd4 G A 2: 24,394,294 D57N probably benign Het
Pxdn G A 12: 30,005,829 R1238Q probably benign Het
Spata32 T C 11: 103,209,827 N38S probably benign Het
St5 G A 7: 109,531,130 A888V probably damaging Het
Tpr A G 1: 150,403,956 T279A probably benign Het
Unc13a C A 8: 71,658,314 E418* probably null Het
Zfp474 A T 18: 52,638,719 Q148L possibly damaging Het
Other mutations in Vmn2r97
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r97 APN 17 18947659 missense probably benign 0.37
IGL00962:Vmn2r97 APN 17 18929228 missense probably damaging 1.00
IGL01704:Vmn2r97 APN 17 18947811 missense probably damaging 0.99
IGL01888:Vmn2r97 APN 17 18929024 nonsense probably null
IGL02429:Vmn2r97 APN 17 18930334 missense possibly damaging 0.94
IGL02742:Vmn2r97 APN 17 18929170 missense probably damaging 0.97
IGL02934:Vmn2r97 APN 17 18929685 missense probably benign 0.00
IGL02978:Vmn2r97 APN 17 18948036 missense probably benign 0.01
IGL03230:Vmn2r97 APN 17 18929406 missense probably benign 0.10
IGL03241:Vmn2r97 APN 17 18928176 missense probably benign 0.11
IGL03050:Vmn2r97 UTSW 17 18947638 missense possibly damaging 0.84
R0482:Vmn2r97 UTSW 17 18947668 missense probably damaging 1.00
R0514:Vmn2r97 UTSW 17 18914472 missense probably benign 0.25
R0944:Vmn2r97 UTSW 17 18947403 missense probably benign 0.13
R1061:Vmn2r97 UTSW 17 18928178 nonsense probably null
R1546:Vmn2r97 UTSW 17 18947848 missense probably damaging 1.00
R1725:Vmn2r97 UTSW 17 18929135 missense probably benign 0.43
R1860:Vmn2r97 UTSW 17 18947386 missense probably benign 0.01
R1938:Vmn2r97 UTSW 17 18929331 missense probably benign 0.01
R1944:Vmn2r97 UTSW 17 18940238 missense probably benign 0.00
R2027:Vmn2r97 UTSW 17 18929682 missense unknown
R2106:Vmn2r97 UTSW 17 18947838 missense probably damaging 1.00
R2151:Vmn2r97 UTSW 17 18947322 nonsense probably null
R2153:Vmn2r97 UTSW 17 18947322 nonsense probably null
R2154:Vmn2r97 UTSW 17 18947322 nonsense probably null
R2516:Vmn2r97 UTSW 17 18947552 missense probably benign
R3739:Vmn2r97 UTSW 17 18928151 missense probably damaging 1.00
R3744:Vmn2r97 UTSW 17 18929628 missense probably benign
R3885:Vmn2r97 UTSW 17 18928334 missense possibly damaging 0.90
R3899:Vmn2r97 UTSW 17 18947611 missense probably damaging 0.96
R4115:Vmn2r97 UTSW 17 18928070 missense probably benign 0.01
R4247:Vmn2r97 UTSW 17 18947280 missense possibly damaging 0.83
R4287:Vmn2r97 UTSW 17 18948075 intron probably benign
R4439:Vmn2r97 UTSW 17 18930354 missense probably benign 0.00
R4523:Vmn2r97 UTSW 17 18929071 missense probably benign 0.03
R4783:Vmn2r97 UTSW 17 18929288 missense probably benign
R4948:Vmn2r97 UTSW 17 18947299 missense possibly damaging 0.95
R4981:Vmn2r97 UTSW 17 18940174 nonsense probably null
R5029:Vmn2r97 UTSW 17 18947911 missense probably damaging 1.00
R5200:Vmn2r97 UTSW 17 18928353 missense probably damaging 1.00
R5541:Vmn2r97 UTSW 17 18928355 nonsense probably null
R5637:Vmn2r97 UTSW 17 18947366 nonsense probably null
R5765:Vmn2r97 UTSW 17 18947180 nonsense probably null
R5885:Vmn2r97 UTSW 17 18947773 missense possibly damaging 0.50
R6272:Vmn2r97 UTSW 17 18947599 missense possibly damaging 0.70
R6553:Vmn2r97 UTSW 17 18930304 nonsense probably null
R6818:Vmn2r97 UTSW 17 18947931 missense possibly damaging 0.95
R6880:Vmn2r97 UTSW 17 18914508 missense probably benign 0.00
R7012:Vmn2r97 UTSW 17 18947494 missense probably damaging 0.99
R7023:Vmn2r97 UTSW 17 18914401 missense probably damaging 1.00
R7044:Vmn2r97 UTSW 17 18914367 missense probably benign 0.05
R7191:Vmn2r97 UTSW 17 18930286 missense probably damaging 1.00
R7503:Vmn2r97 UTSW 17 18928208 missense probably benign
R7862:Vmn2r97 UTSW 17 18947154 missense probably damaging 1.00
R7876:Vmn2r97 UTSW 17 18929064 missense probably damaging 0.97
R7890:Vmn2r97 UTSW 17 18929540 missense probably benign 0.00
R7936:Vmn2r97 UTSW 17 18930400 missense probably damaging 1.00
R7978:Vmn2r97 UTSW 17 18947592 missense probably damaging 1.00
R8405:Vmn2r97 UTSW 17 18914540 critical splice donor site probably null
R8755:Vmn2r97 UTSW 17 18947842 missense probably damaging 1.00
R8790:Vmn2r97 UTSW 17 18940210 missense probably damaging 1.00
R8850:Vmn2r97 UTSW 17 18929345 missense probably benign 0.00
R9060:Vmn2r97 UTSW 17 18914323 start codon destroyed probably null 0.94
R9079:Vmn2r97 UTSW 17 18929378 missense probably benign
R9252:Vmn2r97 UTSW 17 18947587 missense probably benign 0.00
R9278:Vmn2r97 UTSW 17 18914500 missense probably benign 0.00
R9342:Vmn2r97 UTSW 17 18929106 missense probably benign
R9422:Vmn2r97 UTSW 17 18929071 missense probably benign 0.03
R9496:Vmn2r97 UTSW 17 18928965 missense probably damaging 1.00
R9571:Vmn2r97 UTSW 17 18929657 missense probably benign
R9601:Vmn2r97 UTSW 17 18914508 missense probably benign
R9672:Vmn2r97 UTSW 17 18929180 missense probably benign 0.00
R9773:Vmn2r97 UTSW 17 18947959 missense probably benign 0.01
R9795:Vmn2r97 UTSW 17 18947299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGTGCTCATTTTCTGACAC -3'
(R):5'- CCTTGCCCATGATTTCAAAACATC -3'

Sequencing Primer
(F):5'- AGTGCTCATTTTCTGACACTAATTG -3'
(R):5'- CCTAAGTTAGTGGTCTTGCA -3'
Posted On 2019-06-07