Mutagenetix > Incidental Mutations

Incidental Mutation 'PIT4469001:Vmn2r97'

555841

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r97

Ensembl Gene

ENSMUSG00000091491

Gene Name

vomeronasal 2, receptor 97

Synonyms

EG627367

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.086) question?

Stock #

PIT4469001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

18914300-18958087 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 18929616 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 422 (T422K)

Ref Sequence

ENSEMBL: ENSMUSP00000129313 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168710] [ENSMUST00000232219]

Predicted Effect

probably benign
Transcript: ENSMUST00000168710
AA Change: T422K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000129313
Gene: ENSMUSG00000091491
AA Change: T422K

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	82	442	2.9e-36	PFAM
Pfam:NCD3G	513	566	4.9e-21	PFAM
Pfam:7tm_3	599	834	1.7e-52	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000232219
AA Change: T422K

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

Coding Region Coverage

1x: 93.3%
3x: 90.7%
10x: 84.4%
20x: 71.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6030408B16Rik	T	C	15: 101,293,271	V6A	probably benign	Het
A630001G21Rik	A	G	1: 85,725,199	F83L	probably benign	Het
Acsm2	T	A	7: 119,578,185	C308S	possibly damaging	Het
Ak3	A	G	19: 29,047,757	S25P	probably damaging	Het
Atp13a2	T	A	4: 140,994,127	V176E	unknown	Het
Bmper	A	T	9: 23,406,549	H488L	probably benign	Het
Cacna1c	A	T	6: 118,595,972	C2084S	unknown	Het
Ccp110	T	A	7: 118,722,377	N418K	probably benign	Het
Ddx17	C	A	15: 79,543,813	G32C	probably damaging	Het
Dusp16	G	A	6: 134,761,152		probably benign	Het
Efl1	T	G	7: 82,658,165	F90V	probably benign	Het
Ell2	T	A	13: 75,761,892	N252K	probably damaging	Het
Gdf6	T	C	4: 9,859,569	V217A	probably damaging	Het
Gm6205	T	A	5: 94,682,793	V50E	probably damaging	Het
Hint1	T	A	11: 54,870,070	S112T	unknown	Het
Hist1h1e	A	T	13: 23,622,379	V40E	probably damaging	Het
Kif5c	T	C	2: 49,741,348	V679A	probably benign	Het
Lrrn3	A	T	12: 41,453,018	D433E	probably benign	Het
Mast4	G	A	13: 102,804,718	T277M	probably damaging	Het
Naa11	A	G	5: 97,391,626		probably null	Het
Pcdh18	T	A	3: 49,755,069	H599L	probably benign	Het
Pgc	A	T	17: 47,728,755	K25*	probably null	Het
Psd4	G	A	2: 24,394,294	D57N	probably benign	Het
Pxdn	G	A	12: 30,005,829	R1238Q	probably benign	Het
Spata32	T	C	11: 103,209,827	N38S	probably benign	Het
St5	G	A	7: 109,531,130	A888V	probably damaging	Het
Tpr	A	G	1: 150,403,956	T279A	probably benign	Het
Unc13a	C	A	8: 71,658,314	E418*	probably null	Het
Zfp474	A	T	18: 52,638,719	Q148L	possibly damaging	Het

Other mutations in Vmn2r97

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00897:Vmn2r97	APN	17	18947659	missense	probably benign	0.37
IGL00962:Vmn2r97	APN	17	18929228	missense	probably damaging	1.00
IGL01704:Vmn2r97	APN	17	18947811	missense	probably damaging	0.99
IGL01888:Vmn2r97	APN	17	18929024	nonsense	probably null
IGL02429:Vmn2r97	APN	17	18930334	missense	possibly damaging	0.94
IGL02742:Vmn2r97	APN	17	18929170	missense	probably damaging	0.97
IGL02934:Vmn2r97	APN	17	18929685	missense	probably benign	0.00
IGL02978:Vmn2r97	APN	17	18948036	missense	probably benign	0.01
IGL03230:Vmn2r97	APN	17	18929406	missense	probably benign	0.10
IGL03241:Vmn2r97	APN	17	18928176	missense	probably benign	0.11
IGL03050:Vmn2r97	UTSW	17	18947638	missense	possibly damaging	0.84
R0482:Vmn2r97	UTSW	17	18947668	missense	probably damaging	1.00
R0514:Vmn2r97	UTSW	17	18914472	missense	probably benign	0.25
R0944:Vmn2r97	UTSW	17	18947403	missense	probably benign	0.13
R1061:Vmn2r97	UTSW	17	18928178	nonsense	probably null
R1546:Vmn2r97	UTSW	17	18947848	missense	probably damaging	1.00
R1725:Vmn2r97	UTSW	17	18929135	missense	probably benign	0.43
R1860:Vmn2r97	UTSW	17	18947386	missense	probably benign	0.01
R1938:Vmn2r97	UTSW	17	18929331	missense	probably benign	0.01
R1944:Vmn2r97	UTSW	17	18940238	missense	probably benign	0.00
R2027:Vmn2r97	UTSW	17	18929682	missense	unknown
R2106:Vmn2r97	UTSW	17	18947838	missense	probably damaging	1.00
R2151:Vmn2r97	UTSW	17	18947322	nonsense	probably null
R2153:Vmn2r97	UTSW	17	18947322	nonsense	probably null
R2154:Vmn2r97	UTSW	17	18947322	nonsense	probably null
R2516:Vmn2r97	UTSW	17	18947552	missense	probably benign
R3739:Vmn2r97	UTSW	17	18928151	missense	probably damaging	1.00
R3744:Vmn2r97	UTSW	17	18929628	missense	probably benign
R3885:Vmn2r97	UTSW	17	18928334	missense	possibly damaging	0.90
R3899:Vmn2r97	UTSW	17	18947611	missense	probably damaging	0.96
R4115:Vmn2r97	UTSW	17	18928070	missense	probably benign	0.01
R4247:Vmn2r97	UTSW	17	18947280	missense	possibly damaging	0.83
R4287:Vmn2r97	UTSW	17	18948075	intron	probably benign
R4439:Vmn2r97	UTSW	17	18930354	missense	probably benign	0.00
R4523:Vmn2r97	UTSW	17	18929071	missense	probably benign	0.03
R4783:Vmn2r97	UTSW	17	18929288	missense	probably benign
R4948:Vmn2r97	UTSW	17	18947299	missense	possibly damaging	0.95
R4981:Vmn2r97	UTSW	17	18940174	nonsense	probably null
R5029:Vmn2r97	UTSW	17	18947911	missense	probably damaging	1.00
R5200:Vmn2r97	UTSW	17	18928353	missense	probably damaging	1.00
R5541:Vmn2r97	UTSW	17	18928355	nonsense	probably null
R5637:Vmn2r97	UTSW	17	18947366	nonsense	probably null
R5765:Vmn2r97	UTSW	17	18947180	nonsense	probably null
R5885:Vmn2r97	UTSW	17	18947773	missense	possibly damaging	0.50
R6272:Vmn2r97	UTSW	17	18947599	missense	possibly damaging	0.70
R6553:Vmn2r97	UTSW	17	18930304	nonsense	probably null
R6818:Vmn2r97	UTSW	17	18947931	missense	possibly damaging	0.95
R6880:Vmn2r97	UTSW	17	18914508	missense	probably benign	0.00
R7012:Vmn2r97	UTSW	17	18947494	missense	probably damaging	0.99
R7023:Vmn2r97	UTSW	17	18914401	missense	probably damaging	1.00
R7044:Vmn2r97	UTSW	17	18914367	missense	probably benign	0.05
R7191:Vmn2r97	UTSW	17	18930286	missense	probably damaging	1.00
R7503:Vmn2r97	UTSW	17	18928208	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCAAGTGCTCATTTTCTGACAC -3'
(R):5'- CCTTGCCCATGATTTCAAAACATC -3'

Sequencing Primer
(F):5'- AGTGCTCATTTTCTGACACTAATTG -3'
(R):5'- CCTAAGTTAGTGGTCTTGCA -3'

Posted On

2019-06-07