Incidental Mutation 'PIT4469001:Pgc'
ID 555842
Institutional Source Beutler Lab
Gene Symbol Pgc
Ensembl Gene ENSMUSG00000023987
Gene Name progastricsin (pepsinogen C)
Synonyms Upg1, 2210410L06Rik, Upg-1
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # PIT4469001 (G1)
Quality Score 163.009
Status Not validated
Chromosome 17
Chromosomal Location 47726842-47734482 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 47728755 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 25 (K25*)
Ref Sequence ENSEMBL: ENSMUSP00000024782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024782] [ENSMUST00000144955]
AlphaFold Q9D7R7
Predicted Effect probably null
Transcript: ENSMUST00000024782
AA Change: K25*
SMART Domains Protein: ENSMUSP00000024782
Gene: ENSMUSG00000023987
AA Change: K25*

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:A1_Propeptide 18 46 2.1e-17 PFAM
Pfam:Asp 75 391 6.3e-118 PFAM
Pfam:TAXi_N 76 232 7.2e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000144955
AA Change: K25*
SMART Domains Protein: ENSMUSP00000123459
Gene: ENSMUSG00000023987
AA Change: K25*

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:A1_Propeptide 18 46 1.5e-18 PFAM
Pfam:Asp 63 143 1.4e-19 PFAM
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.7%
  • 10x: 84.4%
  • 20x: 71.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an aspartic proteinase that belongs to the peptidase family A1. The encoded protein is a digestive enzyme that is produced in the stomach and constitutes a major component of the gastric mucosa. This protein is also secreted into the serum. This protein is synthesized as an inactive zymogen that includes a highly basic prosegment. This enzyme is converted into its active mature form at low pH by sequential cleavage of the prosegment that is carried out by the enzyme itself. Polymorphisms in this gene are associated with susceptibility to gastric cancers. Serum levels of this enzyme are used as a biomarker for certain gastric diseases including Helicobacter pylori related gastritis. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 1. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030408B16Rik T C 15: 101,293,271 V6A probably benign Het
A630001G21Rik A G 1: 85,725,199 F83L probably benign Het
Acsm2 T A 7: 119,578,185 C308S possibly damaging Het
Ak3 A G 19: 29,047,757 S25P probably damaging Het
Atp13a2 T A 4: 140,994,127 V176E unknown Het
Bmper A T 9: 23,406,549 H488L probably benign Het
Cacna1c A T 6: 118,595,972 C2084S unknown Het
Ccp110 T A 7: 118,722,377 N418K probably benign Het
Ddx17 C A 15: 79,543,813 G32C probably damaging Het
Dusp16 G A 6: 134,761,152 probably benign Het
Efl1 T G 7: 82,658,165 F90V probably benign Het
Ell2 T A 13: 75,761,892 N252K probably damaging Het
Gdf6 T C 4: 9,859,569 V217A probably damaging Het
Gm6205 T A 5: 94,682,793 V50E probably damaging Het
Hint1 T A 11: 54,870,070 S112T unknown Het
Hist1h1e A T 13: 23,622,379 V40E probably damaging Het
Kif5c T C 2: 49,741,348 V679A probably benign Het
Lrrn3 A T 12: 41,453,018 D433E probably benign Het
Mast4 G A 13: 102,804,718 T277M probably damaging Het
Naa11 A G 5: 97,391,626 probably null Het
Pcdh18 T A 3: 49,755,069 H599L probably benign Het
Psd4 G A 2: 24,394,294 D57N probably benign Het
Pxdn G A 12: 30,005,829 R1238Q probably benign Het
Spata32 T C 11: 103,209,827 N38S probably benign Het
St5 G A 7: 109,531,130 A888V probably damaging Het
Tpr A G 1: 150,403,956 T279A probably benign Het
Unc13a C A 8: 71,658,314 E418* probably null Het
Vmn2r97 C A 17: 18,929,616 T422K probably benign Het
Zfp474 A T 18: 52,638,719 Q148L possibly damaging Het
Other mutations in Pgc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Pgc APN 17 47730666 missense probably benign 0.09
IGL01410:Pgc APN 17 47734240 missense probably damaging 0.98
IGL01647:Pgc APN 17 47732404 missense probably damaging 1.00
IGL02141:Pgc APN 17 47726931 missense probably damaging 1.00
IGL02719:Pgc APN 17 47728867 missense probably damaging 0.98
R0736:Pgc UTSW 17 47728780 missense probably damaging 1.00
R1118:Pgc UTSW 17 47728903 critical splice donor site probably null
R1669:Pgc UTSW 17 47733790 missense probably damaging 1.00
R2162:Pgc UTSW 17 47729311 missense probably null 0.96
R3831:Pgc UTSW 17 47729311 missense probably null 0.96
R3833:Pgc UTSW 17 47729311 missense probably null 0.96
R4454:Pgc UTSW 17 47732410 missense probably benign 0.00
R4908:Pgc UTSW 17 47728894 missense probably damaging 0.96
R5544:Pgc UTSW 17 47732504 missense probably benign 0.00
R6829:Pgc UTSW 17 47732781 splice site probably null
R7042:Pgc UTSW 17 47733820 missense probably benign 0.00
R7508:Pgc UTSW 17 47734186 missense probably benign 0.00
R8022:Pgc UTSW 17 47728776 missense probably benign 0.00
R9028:Pgc UTSW 17 47733058 missense possibly damaging 0.51
R9074:Pgc UTSW 17 47732426 missense probably damaging 0.98
Z1176:Pgc UTSW 17 47728868 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATAGAGATTCAGTGGGCGTGC -3'
(R):5'- AAAGGATGTGTGCAACCCAG -3'

Sequencing Primer
(F):5'- CTTGGGGGCAGACTGGCAG -3'
(R):5'- GCAGAAGACCTTTTGGCAGC -3'
Posted On 2019-06-07