Incidental Mutation 'PIT4469001:Zfp474'
ID555843
Institutional Source Beutler Lab
Gene Symbol Zfp474
Ensembl Gene ENSMUSG00000046886
Gene Namezinc finger protein 474
Synonyms4933409D10Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #PIT4469001 (G1)
Quality Score197.009
Status Not validated
Chromosome18
Chromosomal Location52615915-52639830 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 52638719 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 148 (Q148L)
Ref Sequence ENSEMBL: ENSMUSP00000072453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072666] [ENSMUST00000209270]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072666
AA Change: Q148L

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000072453
Gene: ENSMUSG00000046886
AA Change: Q148L

DomainStartEndE-ValueType
Pfam:zf-C2HC_2 90 114 1.8e-10 PFAM
Pfam:zf-C2HC_2 161 185 3.3e-13 PFAM
Pfam:zf-C2HC_2 217 241 1.2e-10 PFAM
low complexity region 250 267 N/A INTRINSIC
Pfam:zf-C2HC_2 280 304 1.1e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000209270
AA Change: Q148L

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.7%
  • 10x: 84.4%
  • 20x: 71.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030408B16Rik T C 15: 101,293,271 V6A probably benign Het
A630001G21Rik A G 1: 85,725,199 F83L probably benign Het
Acsm2 T A 7: 119,578,185 C308S possibly damaging Het
Ak3 A G 19: 29,047,757 S25P probably damaging Het
Atp13a2 T A 4: 140,994,127 V176E unknown Het
Bmper A T 9: 23,406,549 H488L probably benign Het
Cacna1c A T 6: 118,595,972 C2084S unknown Het
Ccp110 T A 7: 118,722,377 N418K probably benign Het
Ddx17 C A 15: 79,543,813 G32C probably damaging Het
Dusp16 G A 6: 134,761,152 probably benign Het
Efl1 T G 7: 82,658,165 F90V probably benign Het
Ell2 T A 13: 75,761,892 N252K probably damaging Het
Gdf6 T C 4: 9,859,569 V217A probably damaging Het
Gm6205 T A 5: 94,682,793 V50E probably damaging Het
Hint1 T A 11: 54,870,070 S112T unknown Het
Hist1h1e A T 13: 23,622,379 V40E probably damaging Het
Kif5c T C 2: 49,741,348 V679A probably benign Het
Lrrn3 A T 12: 41,453,018 D433E probably benign Het
Mast4 G A 13: 102,804,718 T277M probably damaging Het
Naa11 A G 5: 97,391,626 probably null Het
Pcdh18 T A 3: 49,755,069 H599L probably benign Het
Pgc A T 17: 47,728,755 K25* probably null Het
Psd4 G A 2: 24,394,294 D57N probably benign Het
Pxdn G A 12: 30,005,829 R1238Q probably benign Het
Spata32 T C 11: 103,209,827 N38S probably benign Het
St5 G A 7: 109,531,130 A888V probably damaging Het
Tpr A G 1: 150,403,956 T279A probably benign Het
Unc13a C A 8: 71,658,314 E418* probably null Het
Vmn2r97 C A 17: 18,929,616 T422K probably benign Het
Other mutations in Zfp474
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Zfp474 APN 18 52638493 missense possibly damaging 0.52
IGL01651:Zfp474 APN 18 52638583 missense probably damaging 1.00
IGL01750:Zfp474 APN 18 52639277 missense possibly damaging 0.59
IGL02013:Zfp474 APN 18 52638899 missense possibly damaging 0.86
PIT4618001:Zfp474 UTSW 18 52638404 missense probably damaging 0.97
R0615:Zfp474 UTSW 18 52638349 missense probably benign 0.02
R1178:Zfp474 UTSW 18 52638742 nonsense probably null
R1180:Zfp474 UTSW 18 52638742 nonsense probably null
R1610:Zfp474 UTSW 18 52638365 missense probably benign
R1819:Zfp474 UTSW 18 52638800 missense probably damaging 1.00
R4854:Zfp474 UTSW 18 52638431 missense possibly damaging 0.59
R6270:Zfp474 UTSW 18 52638364 missense probably benign
R7574:Zfp474 UTSW 18 52639189 missense probably benign 0.00
R8194:Zfp474 UTSW 18 52639157 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTATGTCAGAAACCCAGCCTAGAC -3'
(R):5'- CCGCTAGAAGCTTTCTTGAGAC -3'

Sequencing Primer
(F):5'- AGCCTAGACCCCCTGTGATC -3'
(R):5'- GCTTTCTTGAGACCAGTAGGAAC -3'
Posted On2019-06-07