Incidental Mutation 'PIT4469001:Ak3'
ID555844
Institutional Source Beutler Lab
Gene Symbol Ak3
Ensembl Gene ENSMUSG00000024782
Gene Nameadenylate kinase 3
SynonymsAK-3
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.357) question?
Stock #PIT4469001 (G1)
Quality Score136.008
Status Not validated
Chromosome19
Chromosomal Location29020833-29047961 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29047757 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 25 (S25P)
Ref Sequence ENSEMBL: ENSMUSP00000025696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025696]
Predicted Effect probably damaging
Transcript: ENSMUST00000025696
AA Change: S25P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000025696
Gene: ENSMUSG00000024782
AA Change: S25P

DomainStartEndE-ValueType
Pfam:AAA_17 9 172 2.4e-7 PFAM
Pfam:ADK 12 192 2.6e-52 PFAM
Pfam:ADK_lid 128 163 4.3e-17 PFAM
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.7%
  • 10x: 84.4%
  • 20x: 71.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTP:ATP phosphotransferase that is found in the mitochondrial matrix. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030408B16Rik T C 15: 101,293,271 V6A probably benign Het
A630001G21Rik A G 1: 85,725,199 F83L probably benign Het
Acsm2 T A 7: 119,578,185 C308S possibly damaging Het
Atp13a2 T A 4: 140,994,127 V176E unknown Het
Bmper A T 9: 23,406,549 H488L probably benign Het
Cacna1c A T 6: 118,595,972 C2084S unknown Het
Ccp110 T A 7: 118,722,377 N418K probably benign Het
Ddx17 C A 15: 79,543,813 G32C probably damaging Het
Dusp16 G A 6: 134,761,152 probably benign Het
Efl1 T G 7: 82,658,165 F90V probably benign Het
Ell2 T A 13: 75,761,892 N252K probably damaging Het
Gdf6 T C 4: 9,859,569 V217A probably damaging Het
Gm6205 T A 5: 94,682,793 V50E probably damaging Het
Hint1 T A 11: 54,870,070 S112T unknown Het
Hist1h1e A T 13: 23,622,379 V40E probably damaging Het
Kif5c T C 2: 49,741,348 V679A probably benign Het
Lrrn3 A T 12: 41,453,018 D433E probably benign Het
Mast4 G A 13: 102,804,718 T277M probably damaging Het
Naa11 A G 5: 97,391,626 probably null Het
Pcdh18 T A 3: 49,755,069 H599L probably benign Het
Pgc A T 17: 47,728,755 K25* probably null Het
Psd4 G A 2: 24,394,294 D57N probably benign Het
Pxdn G A 12: 30,005,829 R1238Q probably benign Het
Spata32 T C 11: 103,209,827 N38S probably benign Het
St5 G A 7: 109,531,130 A888V probably damaging Het
Tpr A G 1: 150,403,956 T279A probably benign Het
Unc13a C A 8: 71,658,314 E418* probably null Het
Vmn2r97 C A 17: 18,929,616 T422K probably benign Het
Zfp474 A T 18: 52,638,719 Q148L possibly damaging Het
Other mutations in Ak3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03162:Ak3 APN 19 29022836 missense possibly damaging 0.61
PIT4243001:Ak3 UTSW 19 29037871 critical splice donor site probably null
R0277:Ak3 UTSW 19 29047792 missense possibly damaging 0.80
R0855:Ak3 UTSW 19 29022945 missense probably benign
R1747:Ak3 UTSW 19 29022861 missense possibly damaging 0.87
R2141:Ak3 UTSW 19 29022847 missense probably benign 0.00
R3979:Ak3 UTSW 19 29047718 missense probably damaging 1.00
R4839:Ak3 UTSW 19 29047732 missense probably damaging 0.99
R6207:Ak3 UTSW 19 29022940 missense probably damaging 0.99
R6702:Ak3 UTSW 19 29026227 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCAGCTGTGTCGAATGAG -3'
(R):5'- CTAGAAGTAGAACGGGGTGCTC -3'

Sequencing Primer
(F):5'- GCTGTGTCGAATGAGCTTCTAAAAAC -3'
(R):5'- GTGCTCAGAGGTTGTCCAC -3'
Posted On2019-06-07