Mutagenetix > Incidental Mutations

Incidental Mutation 'PIT4469001:Ak3'

555844

Institutional Source

Beutler Lab

Gene Symbol

Ak3

Ensembl Gene

ENSMUSG00000024782

Gene Name

adenylate kinase 3

Synonyms

AK-3

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.357) question?

Stock #

PIT4469001 (G1)

Quality Score

136.008

Status

Not validated

Chromosome

Chromosomal Location

29020833-29047961 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 29047757 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 25 (S25P)

Ref Sequence

ENSEMBL: ENSMUSP00000025696 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025696]

Predicted Effect

probably damaging
Transcript: ENSMUST00000025696
AA Change: S25P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000025696
Gene: ENSMUSG00000024782
AA Change: S25P

Domain	Start	End	E-Value	Type
Pfam:AAA_17	9	172	2.4e-7	PFAM
Pfam:ADK	12	192	2.6e-52	PFAM
Pfam:ADK_lid	128	163	4.3e-17	PFAM

Coding Region Coverage

1x: 93.3%
3x: 90.7%
10x: 84.4%
20x: 71.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTP:ATP phosphotransferase that is found in the mitochondrial matrix. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6030408B16Rik	T	C	15: 101,293,271	V6A	probably benign	Het
A630001G21Rik	A	G	1: 85,725,199	F83L	probably benign	Het
Acsm2	T	A	7: 119,578,185	C308S	possibly damaging	Het
Atp13a2	T	A	4: 140,994,127	V176E	unknown	Het
Bmper	A	T	9: 23,406,549	H488L	probably benign	Het
Cacna1c	A	T	6: 118,595,972	C2084S	unknown	Het
Ccp110	T	A	7: 118,722,377	N418K	probably benign	Het
Ddx17	C	A	15: 79,543,813	G32C	probably damaging	Het
Dusp16	G	A	6: 134,761,152		probably benign	Het
Efl1	T	G	7: 82,658,165	F90V	probably benign	Het
Ell2	T	A	13: 75,761,892	N252K	probably damaging	Het
Gdf6	T	C	4: 9,859,569	V217A	probably damaging	Het
Gm6205	T	A	5: 94,682,793	V50E	probably damaging	Het
Hint1	T	A	11: 54,870,070	S112T	unknown	Het
Hist1h1e	A	T	13: 23,622,379	V40E	probably damaging	Het
Kif5c	T	C	2: 49,741,348	V679A	probably benign	Het
Lrrn3	A	T	12: 41,453,018	D433E	probably benign	Het
Mast4	G	A	13: 102,804,718	T277M	probably damaging	Het
Naa11	A	G	5: 97,391,626		probably null	Het
Pcdh18	T	A	3: 49,755,069	H599L	probably benign	Het
Pgc	A	T	17: 47,728,755	K25*	probably null	Het
Psd4	G	A	2: 24,394,294	D57N	probably benign	Het
Pxdn	G	A	12: 30,005,829	R1238Q	probably benign	Het
Spata32	T	C	11: 103,209,827	N38S	probably benign	Het
St5	G	A	7: 109,531,130	A888V	probably damaging	Het
Tpr	A	G	1: 150,403,956	T279A	probably benign	Het
Unc13a	C	A	8: 71,658,314	E418*	probably null	Het
Vmn2r97	C	A	17: 18,929,616	T422K	probably benign	Het
Zfp474	A	T	18: 52,638,719	Q148L	possibly damaging	Het

Other mutations in Ak3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03162:Ak3	APN	19	29022836	missense	possibly damaging	0.61
PIT4243001:Ak3	UTSW	19	29037871	critical splice donor site	probably null
R0277:Ak3	UTSW	19	29047792	missense	possibly damaging	0.80
R0855:Ak3	UTSW	19	29022945	missense	probably benign
R1747:Ak3	UTSW	19	29022861	missense	possibly damaging	0.87
R2141:Ak3	UTSW	19	29022847	missense	probably benign	0.00
R3979:Ak3	UTSW	19	29047718	missense	probably damaging	1.00
R4839:Ak3	UTSW	19	29047732	missense	probably damaging	0.99
R6207:Ak3	UTSW	19	29022940	missense	probably damaging	0.99
R6702:Ak3	UTSW	19	29026227	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCCAGCTGTGTCGAATGAG -3'
(R):5'- CTAGAAGTAGAACGGGGTGCTC -3'

Sequencing Primer
(F):5'- GCTGTGTCGAATGAGCTTCTAAAAAC -3'
(R):5'- GTGCTCAGAGGTTGTCCAC -3'

Posted On

2019-06-07