Incidental Mutation 'R0604:Vmn1r69'
ID55586
Institutional Source Beutler Lab
Gene Symbol Vmn1r69
Ensembl Gene ENSMUSG00000091662
Gene Namevomeronasal 1 receptor 69
SynonymsV1re9
MMRRC Submission 038793-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R0604 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location10578930-10613659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10580654 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 50 (V50A)
Ref Sequence ENSEMBL: ENSMUSP00000154076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163658] [ENSMUST00000176284] [ENSMUST00000176707] [ENSMUST00000226160] [ENSMUST00000226190] [ENSMUST00000226228] [ENSMUST00000227853] [ENSMUST00000228296] [ENSMUST00000228478] [ENSMUST00000228638]
Predicted Effect probably benign
Transcript: ENSMUST00000163658
AA Change: V50A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000129646
Gene: ENSMUSG00000091662
AA Change: V50A

DomainStartEndE-ValueType
Pfam:V1R 50 307 3.3e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176284
AA Change: V50A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000176707
AA Change: V50A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000226160
AA Change: V50A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000226190
AA Change: V50A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000226228
AA Change: V50A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226990
Predicted Effect probably benign
Transcript: ENSMUST00000227853
Predicted Effect probably benign
Transcript: ENSMUST00000228296
Predicted Effect probably benign
Transcript: ENSMUST00000228478
Predicted Effect probably benign
Transcript: ENSMUST00000228638
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik C A 2: 28,466,091 R60L possibly damaging Het
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Acap1 T C 11: 69,884,625 E302G probably benign Het
Adrb2 G A 18: 62,178,515 T413I possibly damaging Het
Aqr T C 2: 114,130,604 K725R probably benign Het
Braf A G 6: 39,623,697 I662T probably damaging Het
Ccdc178 A G 18: 22,067,443 S435P probably benign Het
Chd9 A G 8: 91,036,542 M2332V possibly damaging Het
Clgn T C 8: 83,424,194 V496A probably benign Het
Dnah17 A C 11: 118,121,471 S193R probably benign Het
Dntt A G 19: 41,053,149 E424G probably benign Het
Fam149a A G 8: 45,345,008 L492P probably damaging Het
Fetub T C 16: 22,935,660 Y126H possibly damaging Het
Fgfr3 A T 5: 33,732,782 Y96F probably damaging Het
Gm4952 A G 19: 12,624,672 E148G probably benign Het
Gucy2g T A 19: 55,203,087 L977F probably benign Het
Il1r1 T C 1: 40,282,246 V6A probably benign Het
Itsn2 C A 12: 4,658,189 Q832K probably benign Het
Lats1 T A 10: 7,712,661 F1014Y probably damaging Het
Mcc G A 18: 44,473,756 A536V probably damaging Het
Mtrf1 T C 14: 79,415,887 V334A possibly damaging Het
Olfr1179 T C 2: 88,402,383 T184A probably benign Het
Olfr325 T A 11: 58,581,348 M168K probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr50 T A 2: 36,794,107 Y290* probably null Het
Pard6g A G 18: 80,117,208 S179G probably damaging Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Psg27 A T 7: 18,557,072 V402D probably damaging Het
Rttn A G 18: 88,977,758 I222V probably damaging Het
Sp9 T A 2: 73,273,638 S179T probably benign Het
Tbc1d8 T A 1: 39,405,326 H184L probably damaging Het
Vmn2r58 A G 7: 41,860,576 F526L possibly damaging Het
Other mutations in Vmn1r69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Vmn1r69 APN 7 10579952 missense probably benign 0.00
IGL01972:Vmn1r69 APN 7 10580659 nonsense probably null
IGL02339:Vmn1r69 APN 7 10580718 nonsense probably null
IGL02424:Vmn1r69 APN 7 10580658 missense probably benign 0.00
IGL02602:Vmn1r69 APN 7 10579974 missense probably benign 0.14
IGL03271:Vmn1r69 APN 7 10580669 missense probably benign 0.11
R0034:Vmn1r69 UTSW 7 10580811 intron probably benign
R0052:Vmn1r69 UTSW 7 10580400 missense probably benign 0.00
R0096:Vmn1r69 UTSW 7 10580058 missense probably damaging 1.00
R0539:Vmn1r69 UTSW 7 10580947 splice site probably benign
R1681:Vmn1r69 UTSW 7 10580252 missense probably benign 0.06
R1884:Vmn1r69 UTSW 7 10580751 missense probably benign 0.00
R3741:Vmn1r69 UTSW 7 10580142 missense possibly damaging 0.47
R4655:Vmn1r69 UTSW 7 10580099 missense probably benign 0.03
R4735:Vmn1r69 UTSW 7 10580999 utr 5 prime probably benign
R4758:Vmn1r69 UTSW 7 10580546 missense probably benign 0.00
R5582:Vmn1r69 UTSW 7 10580508 missense probably damaging 1.00
R5966:Vmn1r69 UTSW 7 10580790 missense probably benign 0.00
R5977:Vmn1r69 UTSW 7 10580490 missense probably damaging 1.00
R6458:Vmn1r69 UTSW 7 10580438 missense probably benign
R6987:Vmn1r69 UTSW 7 10580564 start codon destroyed probably null 0.99
R7133:Vmn1r69 UTSW 7 10581068 intron probably benign
R7532:Vmn1r69 UTSW 7 10580354 missense probably damaging 0.98
R7878:Vmn1r69 UTSW 7 10580790 missense probably benign 0.00
Z1176:Vmn1r69 UTSW 7 10580096 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- GCCAATGGATATACTCCGGCCAAC -3'
(R):5'- TGGAACCATCTGATTTAGCCAATGAGG -3'

Sequencing Primer
(F):5'- CCGGCCAACTCTTTGAATG -3'
(R):5'- TAGCCAATGAGGAACTCTTCAG -3'
Posted On2013-07-11