Incidental Mutation 'PIT4472001:Vmn2r23'
ID 555860
Institutional Source Beutler Lab
Gene Symbol Vmn2r23
Ensembl Gene ENSMUSG00000091620
Gene Name vomeronasal 2, receptor 23
Synonyms EG435916
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # PIT4472001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 123679780-123719198 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 123689936 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 271 (T271A)
Ref Sequence ENSEMBL: ENSMUSP00000126682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172391]
AlphaFold E9PXI5
Predicted Effect possibly damaging
Transcript: ENSMUST00000172391
AA Change: T271A

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: T271A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 79 461 1.7e-31 PFAM
Pfam:NCD3G 513 566 1.2e-23 PFAM
Pfam:7tm_3 596 834 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 93.7%
  • 3x: 90.8%
  • 10x: 84.2%
  • 20x: 70.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt C A 9: 99,502,613 (GRCm39) P258T probably damaging Het
Arvcf T C 16: 18,221,699 (GRCm39) V714A possibly damaging Het
Bcas3 A G 11: 85,422,726 (GRCm39) I532V probably damaging Het
Cbr1 T A 16: 93,406,692 (GRCm39) V136E probably damaging Het
Ccdc27 T C 4: 154,126,184 (GRCm39) M102V unknown Het
Ccr1 T C 9: 123,763,765 (GRCm39) Y255C probably damaging Het
Cd300e T A 11: 114,945,336 (GRCm39) I153F possibly damaging Het
Chd7 C T 4: 8,753,101 (GRCm39) L533F unknown Het
Cpvl A T 6: 53,873,464 (GRCm39) F424Y possibly damaging Het
Cxcl16 C T 11: 70,349,625 (GRCm39) G80R probably damaging Het
Cyp2g1 T C 7: 26,513,619 (GRCm39) V186A probably benign Het
Cyp4f15 T A 17: 32,921,798 (GRCm39) M490K probably damaging Het
D630045J12Rik A T 6: 38,155,774 (GRCm39) V1160D probably damaging Het
Dennd2b G A 7: 109,130,337 (GRCm39) A888V probably damaging Het
Fbn1 T C 2: 125,148,421 (GRCm39) D2609G possibly damaging Het
Fgf5 T A 5: 98,409,838 (GRCm39) V129E probably damaging Het
Fhl5 C A 4: 25,211,194 (GRCm39) C166F probably damaging Het
Frem1 G A 4: 82,890,374 (GRCm39) T1035I probably benign Het
Gcnt2 G A 13: 41,071,413 (GRCm39) V19M probably benign Het
Gga1 C A 15: 78,777,836 (GRCm39) A595D probably damaging Het
Gpaa1 C T 15: 76,218,940 (GRCm39) T594I probably benign Het
Gskip C T 12: 105,651,121 (GRCm39) probably benign Het
Ighv1-72 A G 12: 115,721,620 (GRCm39) V112A probably damaging Het
Krt16 T A 11: 100,138,732 (GRCm39) T185S probably benign Het
Lama1 T C 17: 68,071,699 (GRCm39) V862A Het
Lats2 A C 14: 57,936,814 (GRCm39) Y558* probably null Het
Mast4 G A 13: 102,941,226 (GRCm39) T277M probably damaging Het
Mnx1 T C 5: 29,679,105 (GRCm39) E326G unknown Het
Mtmr10 A G 7: 63,983,106 (GRCm39) E471G probably benign Het
Or5p64 C T 7: 107,855,310 (GRCm39) V12M possibly damaging Het
Otog G A 7: 45,945,273 (GRCm39) V2177M probably damaging Het
Ovgp1 A G 3: 105,894,306 (GRCm39) E693G unknown Het
Pclo T C 5: 14,763,182 (GRCm39) M600T possibly damaging Het
Pdgfra T A 5: 75,340,907 (GRCm39) M622K probably damaging Het
Pdxdc1 A G 16: 13,663,209 (GRCm39) L428P probably damaging Het
Pfkfb4 T C 9: 108,828,222 (GRCm39) Y86H probably benign Het
Pik3cg A G 12: 32,254,983 (GRCm39) Y335H probably damaging Het
Podnl1 G A 8: 84,854,477 (GRCm39) V150M Het
Pou4f3 A G 18: 42,527,717 (GRCm39) M4V probably benign Het
Ppp1r13b G A 12: 111,799,074 (GRCm39) R864C probably damaging Het
R3hdm4 A G 10: 79,749,389 (GRCm39) probably null Het
Skil T A 3: 31,152,381 (GRCm39) V301D probably damaging Het
Sptb G A 12: 76,667,460 (GRCm39) T879M probably damaging Het
Strip1 G A 3: 107,535,486 (GRCm39) A79V probably benign Het
Tpgs2 G A 18: 25,301,652 (GRCm39) T5M possibly damaging Het
Trim34a T A 7: 103,897,155 (GRCm39) L73Q probably damaging Het
Trpv4 T A 5: 114,764,984 (GRCm39) T677S probably damaging Het
Other mutations in Vmn2r23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Vmn2r23 APN 6 123,706,684 (GRCm39) missense possibly damaging 0.89
IGL01012:Vmn2r23 APN 6 123,706,555 (GRCm39) missense probably benign
IGL01073:Vmn2r23 APN 6 123,689,759 (GRCm39) missense possibly damaging 0.82
IGL01547:Vmn2r23 APN 6 123,681,383 (GRCm39) missense possibly damaging 0.88
IGL01571:Vmn2r23 APN 6 123,681,366 (GRCm39) missense probably damaging 1.00
IGL01950:Vmn2r23 APN 6 123,718,845 (GRCm39) missense possibly damaging 0.80
IGL02028:Vmn2r23 APN 6 123,718,819 (GRCm39) missense probably damaging 1.00
IGL02248:Vmn2r23 APN 6 123,718,703 (GRCm39) missense probably damaging 0.96
IGL02318:Vmn2r23 APN 6 123,718,795 (GRCm39) missense probably benign 0.10
IGL02649:Vmn2r23 APN 6 123,681,437 (GRCm39) missense probably benign
IGL02831:Vmn2r23 APN 6 123,681,344 (GRCm39) missense probably benign 0.22
IGL02832:Vmn2r23 APN 6 123,681,355 (GRCm39) missense probably benign 0.00
IGL02865:Vmn2r23 APN 6 123,718,578 (GRCm39) missense probably damaging 1.00
IGL02964:Vmn2r23 APN 6 123,718,741 (GRCm39) missense possibly damaging 0.93
IGL03347:Vmn2r23 APN 6 123,681,333 (GRCm39) missense probably benign 0.01
IGL03396:Vmn2r23 APN 6 123,706,585 (GRCm39) missense probably damaging 1.00
R0597:Vmn2r23 UTSW 6 123,706,680 (GRCm39) missense probably benign 0.08
R0677:Vmn2r23 UTSW 6 123,690,410 (GRCm39) missense probably benign 0.00
R0904:Vmn2r23 UTSW 6 123,719,094 (GRCm39) missense probably damaging 1.00
R1330:Vmn2r23 UTSW 6 123,718,963 (GRCm39) missense probably damaging 1.00
R1424:Vmn2r23 UTSW 6 123,690,229 (GRCm39) nonsense probably null
R1629:Vmn2r23 UTSW 6 123,690,386 (GRCm39) missense probably benign 0.05
R1842:Vmn2r23 UTSW 6 123,706,649 (GRCm39) missense possibly damaging 0.77
R1867:Vmn2r23 UTSW 6 123,679,874 (GRCm39) missense probably damaging 1.00
R1919:Vmn2r23 UTSW 6 123,689,969 (GRCm39) missense possibly damaging 0.94
R2087:Vmn2r23 UTSW 6 123,718,458 (GRCm39) missense probably benign 0.00
R2338:Vmn2r23 UTSW 6 123,681,384 (GRCm39) missense possibly damaging 0.88
R2568:Vmn2r23 UTSW 6 123,719,147 (GRCm39) nonsense probably null
R2867:Vmn2r23 UTSW 6 123,690,123 (GRCm39) missense possibly damaging 0.94
R2867:Vmn2r23 UTSW 6 123,690,123 (GRCm39) missense possibly damaging 0.94
R3500:Vmn2r23 UTSW 6 123,690,129 (GRCm39) missense possibly damaging 0.81
R3789:Vmn2r23 UTSW 6 123,718,348 (GRCm39) missense probably damaging 1.00
R4164:Vmn2r23 UTSW 6 123,706,697 (GRCm39) missense probably benign
R4506:Vmn2r23 UTSW 6 123,679,884 (GRCm39) missense probably damaging 1.00
R4652:Vmn2r23 UTSW 6 123,718,689 (GRCm39) missense probably damaging 1.00
R4697:Vmn2r23 UTSW 6 123,718,785 (GRCm39) missense probably damaging 1.00
R4840:Vmn2r23 UTSW 6 123,690,033 (GRCm39) missense probably damaging 1.00
R4983:Vmn2r23 UTSW 6 123,710,308 (GRCm39) missense probably damaging 1.00
R5276:Vmn2r23 UTSW 6 123,689,936 (GRCm39) missense possibly damaging 0.62
R5392:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R5528:Vmn2r23 UTSW 6 123,689,961 (GRCm39) missense probably damaging 1.00
R5529:Vmn2r23 UTSW 6 123,690,410 (GRCm39) missense probably benign 0.00
R5664:Vmn2r23 UTSW 6 123,690,033 (GRCm39) missense probably damaging 1.00
R5749:Vmn2r23 UTSW 6 123,710,232 (GRCm39) missense probably benign
R5761:Vmn2r23 UTSW 6 123,689,718 (GRCm39) missense probably benign 0.39
R5762:Vmn2r23 UTSW 6 123,710,352 (GRCm39) missense probably damaging 1.00
R5868:Vmn2r23 UTSW 6 123,689,901 (GRCm39) missense probably benign 0.12
R5935:Vmn2r23 UTSW 6 123,718,854 (GRCm39) missense possibly damaging 0.94
R6242:Vmn2r23 UTSW 6 123,681,359 (GRCm39) missense possibly damaging 0.82
R6416:Vmn2r23 UTSW 6 123,689,861 (GRCm39) missense probably damaging 1.00
R6524:Vmn2r23 UTSW 6 123,690,384 (GRCm39) missense probably damaging 1.00
R6576:Vmn2r23 UTSW 6 123,710,232 (GRCm39) missense probably benign
R6925:Vmn2r23 UTSW 6 123,681,512 (GRCm39) missense probably damaging 1.00
R7148:Vmn2r23 UTSW 6 123,689,981 (GRCm39) missense probably benign
R7215:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R7252:Vmn2r23 UTSW 6 123,718,540 (GRCm39) missense probably damaging 0.97
R7403:Vmn2r23 UTSW 6 123,681,538 (GRCm39) missense probably benign 0.01
R8015:Vmn2r23 UTSW 6 123,681,500 (GRCm39) missense probably benign 0.00
R8143:Vmn2r23 UTSW 6 123,718,312 (GRCm39) missense probably damaging 0.99
R8474:Vmn2r23 UTSW 6 123,681,599 (GRCm39) missense probably benign 0.36
R8520:Vmn2r23 UTSW 6 123,718,615 (GRCm39) missense probably damaging 0.99
R8679:Vmn2r23 UTSW 6 123,690,431 (GRCm39) missense probably damaging 0.99
R8713:Vmn2r23 UTSW 6 123,679,991 (GRCm39) missense
R8966:Vmn2r23 UTSW 6 123,719,079 (GRCm39) missense possibly damaging 0.94
R9124:Vmn2r23 UTSW 6 123,719,038 (GRCm39) missense possibly damaging 0.57
R9163:Vmn2r23 UTSW 6 123,718,782 (GRCm39) missense probably damaging 1.00
R9189:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R9451:Vmn2r23 UTSW 6 123,710,352 (GRCm39) missense probably damaging 1.00
R9495:Vmn2r23 UTSW 6 123,689,672 (GRCm39) missense probably benign 0.30
R9514:Vmn2r23 UTSW 6 123,689,672 (GRCm39) missense probably benign 0.30
RF018:Vmn2r23 UTSW 6 123,690,075 (GRCm39) missense probably benign 0.00
T0975:Vmn2r23 UTSW 6 123,690,120 (GRCm39) missense probably benign 0.00
Z1088:Vmn2r23 UTSW 6 123,719,067 (GRCm39) missense probably damaging 0.98
Z1177:Vmn2r23 UTSW 6 123,706,684 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACTGCTGCTATACTTCACTTGGG -3'
(R):5'- GGTTGAACGTCTCTGAGAAAATCC -3'

Sequencing Primer
(F):5'- CTGCTATACTTCACTTGGGTCTGG -3'
(R):5'- CGTCTCTGAGAAAATCCTTGAATCC -3'
Posted On 2019-06-07