Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4472001:Vmn2r23'

555860

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r23

Ensembl Gene

ENSMUSG00000091620

Gene Name

vomeronasal 2, receptor 23

Synonyms

EG435916

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.062) question?

Stock #

PIT4472001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

123702821-123742291 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 123712977 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 271 (T271A)

Ref Sequence

ENSEMBL: ENSMUSP00000126682 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172391]

AlphaFold

E9PXI5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000172391
AA Change: T271A

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: T271A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	79	461	1.7e-31	PFAM
Pfam:NCD3G	513	566	1.2e-23	PFAM
Pfam:7tm_3	596	834	1.5e-55	PFAM

Coding Region Coverage

1x: 93.7%
3x: 90.8%
10x: 84.2%
20x: 70.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A4gnt	C	A	9: 99,620,560	P258T	probably damaging	Het
Arvcf	T	C	16: 18,402,949	V714A	possibly damaging	Het
Bcas3	A	G	11: 85,531,900	I532V	probably damaging	Het
Cbr1	T	A	16: 93,609,804	V136E	probably damaging	Het
Ccdc27	T	C	4: 154,041,727	M102V	unknown	Het
Ccr1	T	C	9: 123,963,728	Y255C	probably damaging	Het
Cd300e	T	A	11: 115,054,510	I153F	possibly damaging	Het
Chd7	C	T	4: 8,753,101	L533F	unknown	Het
Cpvl	A	T	6: 53,896,479	F424Y	possibly damaging	Het
Cxcl16	C	T	11: 70,458,799	G80R	probably damaging	Het
Cyp2g1	T	C	7: 26,814,194	V186A	probably benign	Het
Cyp4f15	T	A	17: 32,702,824	M490K	probably damaging	Het
D630045J12Rik	A	T	6: 38,178,839	V1160D	probably damaging	Het
Fbn1	T	C	2: 125,306,501	D2609G	possibly damaging	Het
Fgf5	T	A	5: 98,261,979	V129E	probably damaging	Het
Fhl5	C	A	4: 25,211,194	C166F	probably damaging	Het
Frem1	G	A	4: 82,972,137	T1035I	probably benign	Het
Gcnt2	G	A	13: 40,917,937	V19M	probably benign	Het
Gga1	C	A	15: 78,893,636	A595D	probably damaging	Het
Gpaa1	C	T	15: 76,334,740	T594I	probably benign	Het
Gskip	C	T	12: 105,684,862		probably benign	Het
Ighv1-72	A	G	12: 115,758,000	V112A	probably damaging	Het
Krt16	T	A	11: 100,247,906	T185S	probably benign	Het
Lama1	T	C	17: 67,764,704	V862A		Het
Lats2	A	C	14: 57,699,357	Y558*	probably null	Het
Mast4	G	A	13: 102,804,718	T277M	probably damaging	Het
Mnx1	T	C	5: 29,474,107	E326G	unknown	Het
Mtmr10	A	G	7: 64,333,358	E471G	probably benign	Het
Olfr488	C	T	7: 108,256,103	V12M	possibly damaging	Het
Otog	G	A	7: 46,295,849	V2177M	probably damaging	Het
Ovgp1	A	G	3: 105,986,990	E693G	unknown	Het
Pclo	T	C	5: 14,713,168	M600T	possibly damaging	Het
Pdgfra	T	A	5: 75,180,246	M622K	probably damaging	Het
Pdxdc1	A	G	16: 13,845,345	L428P	probably damaging	Het
Pfkfb4	T	C	9: 108,999,154	Y86H	probably benign	Het
Pik3cg	A	G	12: 32,204,984	Y335H	probably damaging	Het
Podnl1	G	A	8: 84,127,848	V150M		Het
Pou4f3	A	G	18: 42,394,652	M4V	probably benign	Het
Ppp1r13b	G	A	12: 111,832,640	R864C	probably damaging	Het
R3hdm4	A	G	10: 79,913,555		probably null	Het
Skil	T	A	3: 31,098,232	V301D	probably damaging	Het
Sptb	G	A	12: 76,620,686	T879M	probably damaging	Het
St5	G	A	7: 109,531,130	A888V	probably damaging	Het
Strip1	G	A	3: 107,628,170	A79V	probably benign	Het
Tpgs2	G	A	18: 25,168,595	T5M	possibly damaging	Het
Trim34a	T	A	7: 104,247,948	L73Q	probably damaging	Het
Trpv4	T	A	5: 114,626,923	T677S	probably damaging	Het

Other mutations in Vmn2r23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Vmn2r23	APN	6	123729725	missense	possibly damaging	0.89
IGL01012:Vmn2r23	APN	6	123729596	missense	probably benign
IGL01073:Vmn2r23	APN	6	123712800	missense	possibly damaging	0.82
IGL01547:Vmn2r23	APN	6	123704424	missense	possibly damaging	0.88
IGL01571:Vmn2r23	APN	6	123704407	missense	probably damaging	1.00
IGL01950:Vmn2r23	APN	6	123741886	missense	possibly damaging	0.80
IGL02028:Vmn2r23	APN	6	123741860	missense	probably damaging	1.00
IGL02248:Vmn2r23	APN	6	123741744	missense	probably damaging	0.96
IGL02318:Vmn2r23	APN	6	123741836	missense	probably benign	0.10
IGL02649:Vmn2r23	APN	6	123704478	missense	probably benign
IGL02831:Vmn2r23	APN	6	123704385	missense	probably benign	0.22
IGL02832:Vmn2r23	APN	6	123704396	missense	probably benign	0.00
IGL02865:Vmn2r23	APN	6	123741619	missense	probably damaging	1.00
IGL02964:Vmn2r23	APN	6	123741782	missense	possibly damaging	0.93
IGL03347:Vmn2r23	APN	6	123704374	missense	probably benign	0.01
IGL03396:Vmn2r23	APN	6	123729626	missense	probably damaging	1.00
R0597:Vmn2r23	UTSW	6	123729721	missense	probably benign	0.08
R0677:Vmn2r23	UTSW	6	123713451	missense	probably benign	0.00
R0904:Vmn2r23	UTSW	6	123742135	missense	probably damaging	1.00
R1330:Vmn2r23	UTSW	6	123742004	missense	probably damaging	1.00
R1424:Vmn2r23	UTSW	6	123713270	nonsense	probably null
R1629:Vmn2r23	UTSW	6	123713427	missense	probably benign	0.05
R1842:Vmn2r23	UTSW	6	123729690	missense	possibly damaging	0.77
R1867:Vmn2r23	UTSW	6	123702915	missense	probably damaging	1.00
R1919:Vmn2r23	UTSW	6	123713010	missense	possibly damaging	0.94
R2087:Vmn2r23	UTSW	6	123741499	missense	probably benign	0.00
R2338:Vmn2r23	UTSW	6	123704425	missense	possibly damaging	0.88
R2568:Vmn2r23	UTSW	6	123742188	nonsense	probably null
R2867:Vmn2r23	UTSW	6	123713164	missense	possibly damaging	0.94
R2867:Vmn2r23	UTSW	6	123713164	missense	possibly damaging	0.94
R3500:Vmn2r23	UTSW	6	123713170	missense	possibly damaging	0.81
R3789:Vmn2r23	UTSW	6	123741389	missense	probably damaging	1.00
R4164:Vmn2r23	UTSW	6	123729738	missense	probably benign
R4506:Vmn2r23	UTSW	6	123702925	missense	probably damaging	1.00
R4652:Vmn2r23	UTSW	6	123741730	missense	probably damaging	1.00
R4697:Vmn2r23	UTSW	6	123741826	missense	probably damaging	1.00
R4840:Vmn2r23	UTSW	6	123713074	missense	probably damaging	1.00
R4983:Vmn2r23	UTSW	6	123733349	missense	probably damaging	1.00
R5276:Vmn2r23	UTSW	6	123712977	missense	possibly damaging	0.62
R5392:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R5528:Vmn2r23	UTSW	6	123713002	missense	probably damaging	1.00
R5529:Vmn2r23	UTSW	6	123713451	missense	probably benign	0.00
R5664:Vmn2r23	UTSW	6	123713074	missense	probably damaging	1.00
R5749:Vmn2r23	UTSW	6	123733273	missense	probably benign
R5761:Vmn2r23	UTSW	6	123712759	missense	probably benign	0.39
R5762:Vmn2r23	UTSW	6	123733393	missense	probably damaging	1.00
R5868:Vmn2r23	UTSW	6	123712942	missense	probably benign	0.12
R5935:Vmn2r23	UTSW	6	123741895	missense	possibly damaging	0.94
R6242:Vmn2r23	UTSW	6	123704400	missense	possibly damaging	0.82
R6416:Vmn2r23	UTSW	6	123712902	missense	probably damaging	1.00
R6524:Vmn2r23	UTSW	6	123713425	missense	probably damaging	1.00
R6576:Vmn2r23	UTSW	6	123733273	missense	probably benign
R6925:Vmn2r23	UTSW	6	123704553	missense	probably damaging	1.00
R7148:Vmn2r23	UTSW	6	123713022	missense	probably benign
R7215:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R7252:Vmn2r23	UTSW	6	123741581	missense	probably damaging	0.97
R7403:Vmn2r23	UTSW	6	123704579	missense	probably benign	0.01
R8015:Vmn2r23	UTSW	6	123704541	missense	probably benign	0.00
R8143:Vmn2r23	UTSW	6	123741353	missense	probably damaging	0.99
R8474:Vmn2r23	UTSW	6	123704640	missense	probably benign	0.36
R8520:Vmn2r23	UTSW	6	123741656	missense	probably damaging	0.99
R8679:Vmn2r23	UTSW	6	123713472	missense	probably damaging	0.99
R8713:Vmn2r23	UTSW	6	123703032	missense
R8966:Vmn2r23	UTSW	6	123742120	missense	possibly damaging	0.94
R9124:Vmn2r23	UTSW	6	123742079	missense	possibly damaging	0.57
R9163:Vmn2r23	UTSW	6	123741823	missense	probably damaging	1.00
R9189:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R9451:Vmn2r23	UTSW	6	123733393	missense	probably damaging	1.00
R9495:Vmn2r23	UTSW	6	123712713	missense	probably benign	0.30
R9514:Vmn2r23	UTSW	6	123712713	missense	probably benign	0.30
RF018:Vmn2r23	UTSW	6	123713116	missense	probably benign	0.00
T0975:Vmn2r23	UTSW	6	123713161	missense	probably benign	0.00
Z1088:Vmn2r23	UTSW	6	123742108	missense	probably damaging	0.98
Z1177:Vmn2r23	UTSW	6	123729725	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- ACTGCTGCTATACTTCACTTGGG -3'
(R):5'- GGTTGAACGTCTCTGAGAAAATCC -3'

Sequencing Primer
(F):5'- CTGCTATACTTCACTTGGGTCTGG -3'
(R):5'- CGTCTCTGAGAAAATCCTTGAATCC -3'

Posted On

2019-06-07