Incidental Mutation 'PIT4472001:Trim34a'
ID555864
Institutional Source Beutler Lab
Gene Symbol Trim34a
Ensembl Gene ENSMUSG00000056144
Gene Nametripartite motif-containing 34A
SynonymsTrim34-1, Trim34
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #PIT4472001 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location104244457-104262234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104247948 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 73 (L73Q)
Ref Sequence ENSEMBL: ENSMUSP00000055058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060315] [ENSMUST00000106848] [ENSMUST00000106849]
Predicted Effect probably damaging
Transcript: ENSMUST00000060315
AA Change: L73Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055058
Gene: ENSMUSG00000056144
AA Change: L73Q

DomainStartEndE-ValueType
RING 15 58 6.79e-7 SMART
BBOX 91 132 1.08e-9 SMART
coiled coil region 194 238 N/A INTRINSIC
Blast:PRY 299 343 2e-21 BLAST
Pfam:SPRY 347 474 1e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106848
AA Change: L73Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102461
Gene: ENSMUSG00000056144
AA Change: L73Q

DomainStartEndE-ValueType
RING 15 58 6.79e-7 SMART
BBOX 91 132 1.08e-9 SMART
coiled coil region 194 238 N/A INTRINSIC
Blast:PRY 299 343 2e-21 BLAST
Pfam:SPRY 345 484 6.5e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106849
AA Change: L73Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102462
Gene: ENSMUSG00000056144
AA Change: L73Q

DomainStartEndE-ValueType
RING 15 58 6.79e-7 SMART
BBOX 91 132 1.08e-9 SMART
coiled coil region 194 238 N/A INTRINSIC
Blast:PRY 299 343 2e-21 BLAST
Pfam:SPRY 345 484 6.5e-21 PFAM
Coding Region Coverage
  • 1x: 93.7%
  • 3x: 90.8%
  • 10x: 84.2%
  • 20x: 70.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt C A 9: 99,620,560 P258T probably damaging Het
Arvcf T C 16: 18,402,949 V714A possibly damaging Het
Bcas3 A G 11: 85,531,900 I532V probably damaging Het
Cbr1 T A 16: 93,609,804 V136E probably damaging Het
Ccdc27 T C 4: 154,041,727 M102V unknown Het
Ccr1 T C 9: 123,963,728 Y255C probably damaging Het
Cd300e T A 11: 115,054,510 I153F possibly damaging Het
Chd7 C T 4: 8,753,101 L533F unknown Het
Cpvl A T 6: 53,896,479 F424Y possibly damaging Het
Cxcl16 C T 11: 70,458,799 G80R probably damaging Het
Cyp2g1 T C 7: 26,814,194 V186A probably benign Het
Cyp4f15 T A 17: 32,702,824 M490K probably damaging Het
D630045J12Rik A T 6: 38,178,839 V1160D probably damaging Het
Fbn1 T C 2: 125,306,501 D2609G possibly damaging Het
Fgf5 T A 5: 98,261,979 V129E probably damaging Het
Fhl5 C A 4: 25,211,194 C166F probably damaging Het
Frem1 G A 4: 82,972,137 T1035I probably benign Het
Gcnt2 G A 13: 40,917,937 V19M probably benign Het
Gga1 C A 15: 78,893,636 A595D probably damaging Het
Gpaa1 C T 15: 76,334,740 T594I probably benign Het
Gskip C T 12: 105,684,862 probably benign Het
Ighv1-72 A G 12: 115,758,000 V112A probably damaging Het
Krt16 T A 11: 100,247,906 T185S probably benign Het
Lama1 T C 17: 67,764,704 V862A Het
Lats2 A C 14: 57,699,357 Y558* probably null Het
Mast4 G A 13: 102,804,718 T277M probably damaging Het
Mnx1 T C 5: 29,474,107 E326G unknown Het
Mtmr10 A G 7: 64,333,358 E471G probably benign Het
Olfr488 C T 7: 108,256,103 V12M possibly damaging Het
Otog G A 7: 46,295,849 V2177M probably damaging Het
Ovgp1 A G 3: 105,986,990 E693G unknown Het
Pclo T C 5: 14,713,168 M600T possibly damaging Het
Pdgfra T A 5: 75,180,246 M622K probably damaging Het
Pdxdc1 A G 16: 13,845,345 L428P probably damaging Het
Pfkfb4 T C 9: 108,999,154 Y86H probably benign Het
Pik3cg A G 12: 32,204,984 Y335H probably damaging Het
Podnl1 G A 8: 84,127,848 V150M Het
Pou4f3 A G 18: 42,394,652 M4V probably benign Het
Ppp1r13b G A 12: 111,832,640 R864C probably damaging Het
R3hdm4 A G 10: 79,913,555 probably null Het
Skil T A 3: 31,098,232 V301D probably damaging Het
Sptb G A 12: 76,620,686 T879M probably damaging Het
St5 G A 7: 109,531,130 A888V probably damaging Het
Strip1 G A 3: 107,628,170 A79V probably benign Het
Tpgs2 G A 18: 25,168,595 T5M possibly damaging Het
Trpv4 T A 5: 114,626,923 T677S probably damaging Het
Vmn2r23 A G 6: 123,712,977 T271A possibly damaging Het
Other mutations in Trim34a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Trim34a APN 7 104261331 missense probably damaging 1.00
IGL00826:Trim34a APN 7 104260933 unclassified probably null
IGL01526:Trim34a APN 7 104260499 missense probably damaging 1.00
IGL01859:Trim34a APN 7 104260942 missense probably damaging 0.96
IGL02052:Trim34a APN 7 104247831 missense probably benign 0.33
IGL02192:Trim34a APN 7 104247732 start codon destroyed probably null 1.00
IGL02351:Trim34a APN 7 104261234 nonsense probably null
IGL02358:Trim34a APN 7 104261234 nonsense probably null
IGL03326:Trim34a APN 7 104261380 missense probably benign 0.03
IGL03366:Trim34a APN 7 104260933 unclassified probably null
gold_belt UTSW 7 104261064 nonsense probably null
PIT4791001:Trim34a UTSW 7 104260484 missense probably benign 0.15
R0115:Trim34a UTSW 7 104247902 missense probably damaging 1.00
R0848:Trim34a UTSW 7 104261124 missense probably benign
R1016:Trim34a UTSW 7 104247960 missense probably benign 0.10
R1477:Trim34a UTSW 7 104248080 missense possibly damaging 0.81
R1622:Trim34a UTSW 7 104261338 unclassified probably null
R2287:Trim34a UTSW 7 104261055 missense probably damaging 1.00
R3685:Trim34a UTSW 7 104260126 unclassified probably null
R4166:Trim34a UTSW 7 104261016 missense probably benign 0.02
R4967:Trim34a UTSW 7 104261064 nonsense probably null
R4979:Trim34a UTSW 7 104247862 missense probably benign 0.00
R5194:Trim34a UTSW 7 104260993 missense possibly damaging 0.70
R5443:Trim34a UTSW 7 104260213 missense possibly damaging 0.80
R5631:Trim34a UTSW 7 104248739 missense probably damaging 1.00
R5902:Trim34a UTSW 7 104261121 nonsense probably null
R6147:Trim34a UTSW 7 104261191 missense probably damaging 0.99
R6644:Trim34a UTSW 7 104261037 missense probably damaging 1.00
R8060:Trim34a UTSW 7 104260976 missense not run
X0023:Trim34a UTSW 7 104259415 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- AAGACCACTTGCCCTGTCTG -3'
(R):5'- ATCACGGACTTACCTGACATTC -3'

Sequencing Primer
(F):5'- GTCTGCCAAGAGCTTTTGACCAAAG -3'
(R):5'- CTCCCAGAGGAATGTGTGGTGAC -3'
Posted On2019-06-07