Incidental Mutation 'PIT4472001:Dennd2b'
ID 555866
Institutional Source Beutler Lab
Gene Symbol Dennd2b
Ensembl Gene ENSMUSG00000031024
Gene Name DENN domain containing 2B
Synonyms Denn2b, 2610305K15Rik, St5, 2010004M01Rik
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.390) question?
Stock # PIT4472001 (G1)
Quality Score 172.009
Status Not validated
Chromosome 7
Chromosomal Location 109123118-109302812 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 109130337 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 888 (A888V)
Ref Sequence ENSEMBL: ENSMUSP00000077067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077909] [ENSMUST00000079282] [ENSMUST00000084738] [ENSMUST00000168005]
AlphaFold Q924W7
Predicted Effect probably damaging
Transcript: ENSMUST00000077909
AA Change: A888V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077067
Gene: ENSMUSG00000031024
AA Change: A888V

DomainStartEndE-ValueType
low complexity region 28 46 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 314 326 N/A INTRINSIC
low complexity region 327 348 N/A INTRINSIC
low complexity region 365 379 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
low complexity region 577 609 N/A INTRINSIC
low complexity region 624 638 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
uDENN 690 781 1.16e-30 SMART
DENN 788 972 7.84e-78 SMART
low complexity region 1007 1014 N/A INTRINSIC
dDENN 1019 1086 3.12e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000079282
AA Change: A888V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078264
Gene: ENSMUSG00000031024
AA Change: A888V

DomainStartEndE-ValueType
low complexity region 28 46 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 314 326 N/A INTRINSIC
low complexity region 327 348 N/A INTRINSIC
low complexity region 365 379 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
low complexity region 577 609 N/A INTRINSIC
low complexity region 624 638 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
uDENN 690 781 1.16e-30 SMART
DENN 788 972 7.84e-78 SMART
low complexity region 1007 1014 N/A INTRINSIC
dDENN 1019 1086 3.12e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000084738
AA Change: A471V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000081789
Gene: ENSMUSG00000031024
AA Change: A471V

DomainStartEndE-ValueType
low complexity region 160 192 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
low complexity region 228 239 N/A INTRINSIC
uDENN 273 364 1.16e-30 SMART
DENN 371 555 7.84e-78 SMART
low complexity region 590 597 N/A INTRINSIC
dDENN 602 669 3.12e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168005
AA Change: A471V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130119
Gene: ENSMUSG00000031024
AA Change: A471V

DomainStartEndE-ValueType
low complexity region 160 192 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
low complexity region 228 239 N/A INTRINSIC
uDENN 273 364 1.16e-30 SMART
DENN 371 555 7.84e-78 SMART
low complexity region 590 597 N/A INTRINSIC
dDENN 602 669 3.12e-22 SMART
Coding Region Coverage
  • 1x: 93.7%
  • 3x: 90.8%
  • 10x: 84.2%
  • 20x: 70.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its ability to suppress the tumorigenicity of Hela cells in nude mice. The protein encoded by this gene contains a C-terminal region that shares similarity with the Rab 3 family of small GTP binding proteins. This protein preferentially binds to the SH3 domain of c-Abl kinase, and acts as a regulator of MAPK1/ERK2 kinase, which may contribute to its ability to reduce the tumorigenic phenotype in cells. Three alternatively spliced transcript variants of this gene encoding distinct isoforms are identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt C A 9: 99,502,613 (GRCm39) P258T probably damaging Het
Arvcf T C 16: 18,221,699 (GRCm39) V714A possibly damaging Het
Bcas3 A G 11: 85,422,726 (GRCm39) I532V probably damaging Het
Cbr1 T A 16: 93,406,692 (GRCm39) V136E probably damaging Het
Ccdc27 T C 4: 154,126,184 (GRCm39) M102V unknown Het
Ccr1 T C 9: 123,763,765 (GRCm39) Y255C probably damaging Het
Cd300e T A 11: 114,945,336 (GRCm39) I153F possibly damaging Het
Chd7 C T 4: 8,753,101 (GRCm39) L533F unknown Het
Cpvl A T 6: 53,873,464 (GRCm39) F424Y possibly damaging Het
Cxcl16 C T 11: 70,349,625 (GRCm39) G80R probably damaging Het
Cyp2g1 T C 7: 26,513,619 (GRCm39) V186A probably benign Het
Cyp4f15 T A 17: 32,921,798 (GRCm39) M490K probably damaging Het
D630045J12Rik A T 6: 38,155,774 (GRCm39) V1160D probably damaging Het
Fbn1 T C 2: 125,148,421 (GRCm39) D2609G possibly damaging Het
Fgf5 T A 5: 98,409,838 (GRCm39) V129E probably damaging Het
Fhl5 C A 4: 25,211,194 (GRCm39) C166F probably damaging Het
Frem1 G A 4: 82,890,374 (GRCm39) T1035I probably benign Het
Gcnt2 G A 13: 41,071,413 (GRCm39) V19M probably benign Het
Gga1 C A 15: 78,777,836 (GRCm39) A595D probably damaging Het
Gpaa1 C T 15: 76,218,940 (GRCm39) T594I probably benign Het
Gskip C T 12: 105,651,121 (GRCm39) probably benign Het
Ighv1-72 A G 12: 115,721,620 (GRCm39) V112A probably damaging Het
Krt16 T A 11: 100,138,732 (GRCm39) T185S probably benign Het
Lama1 T C 17: 68,071,699 (GRCm39) V862A Het
Lats2 A C 14: 57,936,814 (GRCm39) Y558* probably null Het
Mast4 G A 13: 102,941,226 (GRCm39) T277M probably damaging Het
Mnx1 T C 5: 29,679,105 (GRCm39) E326G unknown Het
Mtmr10 A G 7: 63,983,106 (GRCm39) E471G probably benign Het
Or5p64 C T 7: 107,855,310 (GRCm39) V12M possibly damaging Het
Otog G A 7: 45,945,273 (GRCm39) V2177M probably damaging Het
Ovgp1 A G 3: 105,894,306 (GRCm39) E693G unknown Het
Pclo T C 5: 14,763,182 (GRCm39) M600T possibly damaging Het
Pdgfra T A 5: 75,340,907 (GRCm39) M622K probably damaging Het
Pdxdc1 A G 16: 13,663,209 (GRCm39) L428P probably damaging Het
Pfkfb4 T C 9: 108,828,222 (GRCm39) Y86H probably benign Het
Pik3cg A G 12: 32,254,983 (GRCm39) Y335H probably damaging Het
Podnl1 G A 8: 84,854,477 (GRCm39) V150M Het
Pou4f3 A G 18: 42,527,717 (GRCm39) M4V probably benign Het
Ppp1r13b G A 12: 111,799,074 (GRCm39) R864C probably damaging Het
R3hdm4 A G 10: 79,749,389 (GRCm39) probably null Het
Skil T A 3: 31,152,381 (GRCm39) V301D probably damaging Het
Sptb G A 12: 76,667,460 (GRCm39) T879M probably damaging Het
Strip1 G A 3: 107,535,486 (GRCm39) A79V probably benign Het
Tpgs2 G A 18: 25,301,652 (GRCm39) T5M possibly damaging Het
Trim34a T A 7: 103,897,155 (GRCm39) L73Q probably damaging Het
Trpv4 T A 5: 114,764,984 (GRCm39) T677S probably damaging Het
Vmn2r23 A G 6: 123,689,936 (GRCm39) T271A possibly damaging Het
Other mutations in Dennd2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Dennd2b APN 7 109,126,915 (GRCm39) missense possibly damaging 0.71
IGL01132:Dennd2b APN 7 109,169,212 (GRCm39) splice site probably null
IGL01288:Dennd2b APN 7 109,139,029 (GRCm39) missense probably damaging 0.96
IGL01645:Dennd2b APN 7 109,126,841 (GRCm39) nonsense probably null
IGL01714:Dennd2b APN 7 109,169,269 (GRCm39) missense probably damaging 0.99
IGL02021:Dennd2b APN 7 109,156,579 (GRCm39) missense probably damaging 1.00
IGL02302:Dennd2b APN 7 109,124,538 (GRCm39) missense probably damaging 1.00
IGL02496:Dennd2b APN 7 109,155,442 (GRCm39) missense possibly damaging 0.83
IGL02795:Dennd2b APN 7 109,155,571 (GRCm39) missense probably damaging 1.00
Bucolic UTSW 7 109,124,755 (GRCm39) nonsense probably null
Halcyon UTSW 7 109,156,000 (GRCm39) nonsense probably null
FR4340:Dennd2b UTSW 7 109,156,128 (GRCm39) unclassified probably benign
FR4737:Dennd2b UTSW 7 109,156,128 (GRCm39) unclassified probably benign
PIT4466001:Dennd2b UTSW 7 109,130,337 (GRCm39) missense probably damaging 1.00
PIT4469001:Dennd2b UTSW 7 109,130,337 (GRCm39) missense probably damaging 1.00
R0024:Dennd2b UTSW 7 109,123,866 (GRCm39) missense probably damaging 1.00
R0124:Dennd2b UTSW 7 109,141,718 (GRCm39) missense possibly damaging 0.66
R0125:Dennd2b UTSW 7 109,155,545 (GRCm39) missense probably benign 0.19
R0365:Dennd2b UTSW 7 109,138,156 (GRCm39) missense probably damaging 1.00
R0491:Dennd2b UTSW 7 109,156,411 (GRCm39) missense probably benign 0.45
R0534:Dennd2b UTSW 7 109,140,635 (GRCm39) missense probably damaging 1.00
R0662:Dennd2b UTSW 7 109,156,633 (GRCm39) missense probably damaging 1.00
R0743:Dennd2b UTSW 7 109,156,552 (GRCm39) missense probably damaging 1.00
R0772:Dennd2b UTSW 7 109,141,527 (GRCm39) splice site probably null
R0774:Dennd2b UTSW 7 109,141,527 (GRCm39) splice site probably null
R0787:Dennd2b UTSW 7 109,124,827 (GRCm39) missense possibly damaging 0.94
R0884:Dennd2b UTSW 7 109,156,552 (GRCm39) missense probably damaging 1.00
R1518:Dennd2b UTSW 7 109,156,562 (GRCm39) missense probably damaging 1.00
R1908:Dennd2b UTSW 7 109,124,533 (GRCm39) nonsense probably null
R1909:Dennd2b UTSW 7 109,124,533 (GRCm39) nonsense probably null
R2232:Dennd2b UTSW 7 109,156,414 (GRCm39) missense probably benign
R2358:Dennd2b UTSW 7 109,155,653 (GRCm39) missense probably benign 0.01
R2847:Dennd2b UTSW 7 109,124,544 (GRCm39) missense probably damaging 1.00
R2869:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2869:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2870:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2870:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2871:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2871:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2873:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2874:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R4534:Dennd2b UTSW 7 109,130,363 (GRCm39) missense probably damaging 1.00
R4536:Dennd2b UTSW 7 109,130,363 (GRCm39) missense probably damaging 1.00
R4559:Dennd2b UTSW 7 109,124,785 (GRCm39) missense probably damaging 1.00
R4798:Dennd2b UTSW 7 109,156,240 (GRCm39) missense probably damaging 0.99
R4846:Dennd2b UTSW 7 109,156,043 (GRCm39) nonsense probably null
R5110:Dennd2b UTSW 7 109,141,697 (GRCm39) missense probably benign 0.02
R5181:Dennd2b UTSW 7 109,155,997 (GRCm39) missense probably benign
R5268:Dennd2b UTSW 7 109,156,519 (GRCm39) missense probably benign
R5403:Dennd2b UTSW 7 109,156,112 (GRCm39) missense probably damaging 1.00
R5836:Dennd2b UTSW 7 109,140,552 (GRCm39) missense possibly damaging 0.78
R5932:Dennd2b UTSW 7 109,169,223 (GRCm39) missense probably damaging 1.00
R5937:Dennd2b UTSW 7 109,156,478 (GRCm39) missense possibly damaging 0.86
R6180:Dennd2b UTSW 7 109,156,095 (GRCm39) missense probably benign 0.11
R6741:Dennd2b UTSW 7 109,144,304 (GRCm39) missense possibly damaging 0.95
R6781:Dennd2b UTSW 7 109,124,511 (GRCm39) missense possibly damaging 0.83
R7086:Dennd2b UTSW 7 109,124,781 (GRCm39) missense probably damaging 1.00
R7466:Dennd2b UTSW 7 109,124,553 (GRCm39) missense probably damaging 1.00
R7644:Dennd2b UTSW 7 109,156,000 (GRCm39) nonsense probably null
R8354:Dennd2b UTSW 7 109,124,755 (GRCm39) nonsense probably null
R8745:Dennd2b UTSW 7 109,156,279 (GRCm39) missense probably benign 0.02
R8859:Dennd2b UTSW 7 109,123,863 (GRCm39) missense probably damaging 1.00
R9016:Dennd2b UTSW 7 109,139,642 (GRCm39) missense possibly damaging 0.84
R9178:Dennd2b UTSW 7 109,156,291 (GRCm39) missense probably benign 0.31
R9361:Dennd2b UTSW 7 109,126,991 (GRCm39) missense probably damaging 1.00
R9564:Dennd2b UTSW 7 109,125,536 (GRCm39) missense probably damaging 1.00
R9595:Dennd2b UTSW 7 109,155,973 (GRCm39) missense probably damaging 0.96
RF062:Dennd2b UTSW 7 109,156,153 (GRCm39) unclassified probably benign
X0067:Dennd2b UTSW 7 109,155,447 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTACCGTGACAATGCACACAC -3'
(R):5'- CGTAAGAGGATTGGAAGCCTTG -3'

Sequencing Primer
(F):5'- CGTGACAATGCACACACATAAGTAGG -3'
(R):5'- GGAAGAGTAGCCAGCAGACACTG -3'
Posted On 2019-06-07