Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4472001:Pfkfb4'

555869

Institutional Source

Beutler Lab

Gene Symbol

Pfkfb4

Ensembl Gene

ENSMUSG00000025648

Gene Name

6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4

Synonyms

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

PIT4472001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

108991778-109032228 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 108999154 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 86 (Y86H)

Ref Sequence

ENSEMBL: ENSMUSP00000142378 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051873] [ENSMUST00000196249] [ENSMUST00000198140] [ENSMUST00000199591]

AlphaFold

Q6DTY7

Predicted Effect

probably benign
Transcript: ENSMUST00000051873
AA Change: Y70H

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000057197
Gene: ENSMUSG00000025648
AA Change: Y70H

Domain	Start	End	E-Value	Type
Pfam:6PF2K	28	249	3.2e-105	PFAM
Pfam:AAA_33	41	199	2.3e-8	PFAM
PGAM	251	398	4.39e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000196249

Predicted Effect

probably benign
Transcript: ENSMUST00000198140
AA Change: Y86H

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000142378
Gene: ENSMUSG00000025648
AA Change: Y86H

Domain	Start	End	E-Value	Type
Pfam:6PF2K	28	249	1.9e-105	PFAM
Pfam:AAA_33	41	198	8.5e-10	PFAM
PGAM	251	398	4.39e-16	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000199591
AA Change: Y86H

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000142992
Gene: ENSMUSG00000025648
AA Change: Y86H

Domain	Start	End	E-Value	Type
Pfam:6PF2K	28	249	1.4e-105	PFAM
Pfam:AAA_33	41	198	6.6e-10	PFAM
PGAM	251	396	4.98e-6	SMART

Coding Region Coverage

1x: 93.7%
3x: 90.8%
10x: 84.2%
20x: 70.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of four bifunctional kinase/phosphatases that regulate the concentration of the glycolytic byproduct fructose-2,6-bisphosphate (F2,6BP). The encoded protein is highly expressed in cancer cells and is induced by hypoxia. This protein is essential to the survival of cancer cells under conditions of hypoxia, because it increases the amount of F2,6BP and ATP at a time when the cell cannot produce much of them. This finding suggests that this protein may be a good target for disruption in cancer cells, hopefully imperiling their survival. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A4gnt	C	A	9: 99,620,560	P258T	probably damaging	Het
Arvcf	T	C	16: 18,402,949	V714A	possibly damaging	Het
Bcas3	A	G	11: 85,531,900	I532V	probably damaging	Het
Cbr1	T	A	16: 93,609,804	V136E	probably damaging	Het
Ccdc27	T	C	4: 154,041,727	M102V	unknown	Het
Ccr1	T	C	9: 123,963,728	Y255C	probably damaging	Het
Cd300e	T	A	11: 115,054,510	I153F	possibly damaging	Het
Chd7	C	T	4: 8,753,101	L533F	unknown	Het
Cpvl	A	T	6: 53,896,479	F424Y	possibly damaging	Het
Cxcl16	C	T	11: 70,458,799	G80R	probably damaging	Het
Cyp2g1	T	C	7: 26,814,194	V186A	probably benign	Het
Cyp4f15	T	A	17: 32,702,824	M490K	probably damaging	Het
D630045J12Rik	A	T	6: 38,178,839	V1160D	probably damaging	Het
Fbn1	T	C	2: 125,306,501	D2609G	possibly damaging	Het
Fgf5	T	A	5: 98,261,979	V129E	probably damaging	Het
Fhl5	C	A	4: 25,211,194	C166F	probably damaging	Het
Frem1	G	A	4: 82,972,137	T1035I	probably benign	Het
Gcnt2	G	A	13: 40,917,937	V19M	probably benign	Het
Gga1	C	A	15: 78,893,636	A595D	probably damaging	Het
Gpaa1	C	T	15: 76,334,740	T594I	probably benign	Het
Gskip	C	T	12: 105,684,862		probably benign	Het
Ighv1-72	A	G	12: 115,758,000	V112A	probably damaging	Het
Krt16	T	A	11: 100,247,906	T185S	probably benign	Het
Lama1	T	C	17: 67,764,704	V862A		Het
Lats2	A	C	14: 57,699,357	Y558*	probably null	Het
Mast4	G	A	13: 102,804,718	T277M	probably damaging	Het
Mnx1	T	C	5: 29,474,107	E326G	unknown	Het
Mtmr10	A	G	7: 64,333,358	E471G	probably benign	Het
Olfr488	C	T	7: 108,256,103	V12M	possibly damaging	Het
Otog	G	A	7: 46,295,849	V2177M	probably damaging	Het
Ovgp1	A	G	3: 105,986,990	E693G	unknown	Het
Pclo	T	C	5: 14,713,168	M600T	possibly damaging	Het
Pdgfra	T	A	5: 75,180,246	M622K	probably damaging	Het
Pdxdc1	A	G	16: 13,845,345	L428P	probably damaging	Het
Pik3cg	A	G	12: 32,204,984	Y335H	probably damaging	Het
Podnl1	G	A	8: 84,127,848	V150M		Het
Pou4f3	A	G	18: 42,394,652	M4V	probably benign	Het
Ppp1r13b	G	A	12: 111,832,640	R864C	probably damaging	Het
R3hdm4	A	G	10: 79,913,555		probably null	Het
Skil	T	A	3: 31,098,232	V301D	probably damaging	Het
Sptb	G	A	12: 76,620,686	T879M	probably damaging	Het
St5	G	A	7: 109,531,130	A888V	probably damaging	Het
Strip1	G	A	3: 107,628,170	A79V	probably benign	Het
Tpgs2	G	A	18: 25,168,595	T5M	possibly damaging	Het
Trim34a	T	A	7: 104,247,948	L73Q	probably damaging	Het
Trpv4	T	A	5: 114,626,923	T677S	probably damaging	Het
Vmn2r23	A	G	6: 123,712,977	T271A	possibly damaging	Het

Other mutations in Pfkfb4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01653:Pfkfb4	APN	9	108999134	missense	probably damaging	1.00
IGL01978:Pfkfb4	APN	9	109028942	missense	probably damaging	1.00
IGL02119:Pfkfb4	APN	9	109025110	missense	probably damaging	1.00
IGL02121:Pfkfb4	APN	9	109025110	missense	probably damaging	1.00
IGL02122:Pfkfb4	APN	9	109025110	missense	probably damaging	1.00
IGL02123:Pfkfb4	APN	9	109025110	missense	probably damaging	1.00
IGL02125:Pfkfb4	APN	9	109025110	missense	probably damaging	1.00
IGL02126:Pfkfb4	APN	9	109025110	missense	probably damaging	1.00
IGL02506:Pfkfb4	APN	9	109030336	missense	probably benign	0.00
IGL02881:Pfkfb4	APN	9	109007296	missense	probably null	1.00
PIT4466001:Pfkfb4	UTSW	9	108999154	missense	probably benign	0.12
R0087:Pfkfb4	UTSW	9	109007701	missense	probably damaging	1.00
R0101:Pfkfb4	UTSW	9	109010643	missense	probably benign	0.03
R0109:Pfkfb4	UTSW	9	108998889	missense	probably benign	0.27
R0109:Pfkfb4	UTSW	9	108998889	missense	probably benign	0.27
R0379:Pfkfb4	UTSW	9	109027742	splice site	probably benign
R0511:Pfkfb4	UTSW	9	109027757	missense	probably damaging	1.00
R1146:Pfkfb4	UTSW	9	109007726	missense	probably benign	0.00
R1146:Pfkfb4	UTSW	9	109007726	missense	probably benign	0.00
R1490:Pfkfb4	UTSW	9	109027620	missense	probably damaging	1.00
R1521:Pfkfb4	UTSW	9	109007305	missense	probably damaging	1.00
R1932:Pfkfb4	UTSW	9	108999169	missense	probably damaging	1.00
R2214:Pfkfb4	UTSW	9	109005609	missense	probably benign	0.17
R3112:Pfkfb4	UTSW	9	109025042	splice site	probably benign
R5470:Pfkfb4	UTSW	9	109027593	missense	probably damaging	1.00
R5646:Pfkfb4	UTSW	9	109008421	missense	probably damaging	1.00
R5930:Pfkfb4	UTSW	9	109030394	unclassified	probably benign
R6139:Pfkfb4	UTSW	9	109027757	missense	probably damaging	1.00
R6632:Pfkfb4	UTSW	9	109009562	splice site	probably null
R6873:Pfkfb4	UTSW	9	109010335	splice site	probably null
R6958:Pfkfb4	UTSW	9	109010547	missense	probably damaging	1.00
R7098:Pfkfb4	UTSW	9	108999154	missense	probably benign	0.05
R7131:Pfkfb4	UTSW	9	109007302	missense	probably benign	0.21
R7148:Pfkfb4	UTSW	9	109027608	missense	probably damaging	0.99
R7284:Pfkfb4	UTSW	9	109011240	missense	possibly damaging	0.88
R7903:Pfkfb4	UTSW	9	108998951	missense	probably damaging	1.00
R7973:Pfkfb4	UTSW	9	109025111	missense	probably damaging	1.00
R8506:Pfkfb4	UTSW	9	109005599	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- TCTAAGAAGCTGACGCGGTAC -3'
(R):5'- TCAGGAGCATTCAGAGTTTGAG -3'

Sequencing Primer
(F):5'- TACCTCAACTGGATTGGCG -3'
(R):5'- TCAGAGTTTGAGAGAGGAGGAACTTC -3'

Posted On

2019-06-07