Incidental Mutation 'PIT4472001:Pik3cg'
ID555876
Institutional Source Beutler Lab
Gene Symbol Pik3cg
Ensembl Gene ENSMUSG00000020573
Gene Namephosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma
SynonymsPI(3)Kgamma, p110gamma, 5830428L06Rik, PI3K, PI3Kgamma
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4472001 (G1)
Quality Score182.009
Status Not validated
Chromosome12
Chromosomal Location32173473-32208659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32204984 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 335 (Y335H)
Ref Sequence ENSEMBL: ENSMUSP00000151400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053215] [ENSMUST00000085469] [ENSMUST00000156904] [ENSMUST00000217915] [ENSMUST00000220366]
Predicted Effect probably damaging
Transcript: ENSMUST00000053215
AA Change: Y335H

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000062864
Gene: ENSMUSG00000020573
AA Change: Y335H

DomainStartEndE-ValueType
PI3K_rbd 203 312 3.56e-43 SMART
PI3K_C2 349 452 1.15e-28 SMART
PI3Ka 541 733 4.41e-89 SMART
PI3Kc 829 1094 3.9e-131 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000085469
AA Change: Y335H

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000082596
Gene: ENSMUSG00000020573
AA Change: Y335H

DomainStartEndE-ValueType
PI3K_rbd 203 312 3.56e-43 SMART
PI3K_C2 349 452 1.15e-28 SMART
PI3Ka 541 733 4.41e-89 SMART
PI3Kc 829 1094 3.9e-131 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126814
Predicted Effect probably damaging
Transcript: ENSMUST00000156904
AA Change: Y335H

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123539
Gene: ENSMUSG00000020573
AA Change: Y335H

DomainStartEndE-ValueType
PI3K_rbd 203 312 3.56e-43 SMART
PI3K_C2 349 452 1.15e-28 SMART
PI3Ka 541 733 4.41e-89 SMART
PI3Kc 829 1094 3.9e-131 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000217915
AA Change: Y335H

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000220366
AA Change: Y335H

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.1159 question?
Coding Region Coverage
  • 1x: 93.7%
  • 3x: 90.8%
  • 10x: 84.2%
  • 20x: 70.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphoinositide 3-kinases (PI3Ks) phosphorylate inositol lipids and are involved in the immune response. The protein encoded by this gene is a class I catalytic subunit of PI3K. Like other class I catalytic subunits (p110-alpha p110-beta, and p110-delta), the encoded protein binds a p85 regulatory subunit to form PI3K. This gene is located in a commonly deleted segment of chromosome 7 previously identified in myeloid leukemias. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jun 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display defects in thymocyte development, T cell activation, and neutrophil migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt C A 9: 99,620,560 P258T probably damaging Het
Arvcf T C 16: 18,402,949 V714A possibly damaging Het
Bcas3 A G 11: 85,531,900 I532V probably damaging Het
Cbr1 T A 16: 93,609,804 V136E probably damaging Het
Ccdc27 T C 4: 154,041,727 M102V unknown Het
Ccr1 T C 9: 123,963,728 Y255C probably damaging Het
Cd300e T A 11: 115,054,510 I153F possibly damaging Het
Chd7 C T 4: 8,753,101 L533F unknown Het
Cpvl A T 6: 53,896,479 F424Y possibly damaging Het
Cxcl16 C T 11: 70,458,799 G80R probably damaging Het
Cyp2g1 T C 7: 26,814,194 V186A probably benign Het
Cyp4f15 T A 17: 32,702,824 M490K probably damaging Het
D630045J12Rik A T 6: 38,178,839 V1160D probably damaging Het
Fbn1 T C 2: 125,306,501 D2609G possibly damaging Het
Fgf5 T A 5: 98,261,979 V129E probably damaging Het
Fhl5 C A 4: 25,211,194 C166F probably damaging Het
Frem1 G A 4: 82,972,137 T1035I probably benign Het
Gcnt2 G A 13: 40,917,937 V19M probably benign Het
Gga1 C A 15: 78,893,636 A595D probably damaging Het
Gpaa1 C T 15: 76,334,740 T594I probably benign Het
Gskip C T 12: 105,684,862 probably benign Het
Ighv1-72 A G 12: 115,758,000 V112A probably damaging Het
Krt16 T A 11: 100,247,906 T185S probably benign Het
Lama1 T C 17: 67,764,704 V862A Het
Lats2 A C 14: 57,699,357 Y558* probably null Het
Mast4 G A 13: 102,804,718 T277M probably damaging Het
Mnx1 T C 5: 29,474,107 E326G unknown Het
Mtmr10 A G 7: 64,333,358 E471G probably benign Het
Olfr488 C T 7: 108,256,103 V12M possibly damaging Het
Otog G A 7: 46,295,849 V2177M probably damaging Het
Ovgp1 A G 3: 105,986,990 E693G unknown Het
Pclo T C 5: 14,713,168 M600T possibly damaging Het
Pdgfra T A 5: 75,180,246 M622K probably damaging Het
Pdxdc1 A G 16: 13,845,345 L428P probably damaging Het
Pfkfb4 T C 9: 108,999,154 Y86H probably benign Het
Podnl1 G A 8: 84,127,848 V150M Het
Pou4f3 A G 18: 42,394,652 M4V probably benign Het
Ppp1r13b G A 12: 111,832,640 R864C probably damaging Het
R3hdm4 A G 10: 79,913,555 probably null Het
Skil T A 3: 31,098,232 V301D probably damaging Het
Sptb G A 12: 76,620,686 T879M probably damaging Het
St5 G A 7: 109,531,130 A888V probably damaging Het
Strip1 G A 3: 107,628,170 A79V probably benign Het
Tpgs2 G A 18: 25,168,595 T5M possibly damaging Het
Trim34a T A 7: 104,247,948 L73Q probably damaging Het
Trpv4 T A 5: 114,626,923 T677S probably damaging Het
Vmn2r23 A G 6: 123,712,977 T271A possibly damaging Het
Other mutations in Pik3cg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Pik3cg APN 12 32205149 missense probably damaging 1.00
IGL02182:Pik3cg APN 12 32205273 missense possibly damaging 0.90
IGL02273:Pik3cg APN 12 32176810 missense probably damaging 1.00
IGL02312:Pik3cg APN 12 32194821 missense possibly damaging 0.55
IGL02752:Pik3cg APN 12 32204263 missense probably damaging 1.00
IGL03107:Pik3cg APN 12 32200595 missense probably damaging 1.00
IGL03139:Pik3cg APN 12 32192223 missense probably damaging 1.00
IGL03267:Pik3cg APN 12 32205308 missense possibly damaging 0.94
IGL03367:Pik3cg APN 12 32192121 missense probably benign 0.01
PIT4283001:Pik3cg UTSW 12 32205865 missense probably damaging 1.00
PIT4514001:Pik3cg UTSW 12 32204903 missense probably damaging 1.00
R0112:Pik3cg UTSW 12 32195715 splice site probably benign
R0145:Pik3cg UTSW 12 32204322 missense probably benign 0.20
R0279:Pik3cg UTSW 12 32204791 missense probably damaging 1.00
R0471:Pik3cg UTSW 12 32194771 missense probably damaging 0.99
R0494:Pik3cg UTSW 12 32204546 missense possibly damaging 0.84
R0573:Pik3cg UTSW 12 32197197 missense probably damaging 1.00
R0631:Pik3cg UTSW 12 32205203 missense probably benign
R0699:Pik3cg UTSW 12 32197342 splice site probably benign
R0826:Pik3cg UTSW 12 32195673 missense possibly damaging 0.78
R1076:Pik3cg UTSW 12 32195714 splice site probably benign
R1101:Pik3cg UTSW 12 32195646 missense probably null 0.98
R1459:Pik3cg UTSW 12 32204984 missense probably damaging 0.99
R1625:Pik3cg UTSW 12 32194742 missense probably damaging 1.00
R1971:Pik3cg UTSW 12 32192153 missense probably damaging 1.00
R1992:Pik3cg UTSW 12 32204025 missense possibly damaging 0.83
R2109:Pik3cg UTSW 12 32193710 missense possibly damaging 0.75
R2319:Pik3cg UTSW 12 32176736 missense probably damaging 0.99
R3421:Pik3cg UTSW 12 32204739 missense probably damaging 1.00
R3422:Pik3cg UTSW 12 32204739 missense probably damaging 1.00
R3740:Pik3cg UTSW 12 32205224 missense probably damaging 1.00
R3777:Pik3cg UTSW 12 32194709 missense probably damaging 0.98
R4300:Pik3cg UTSW 12 32176672 missense probably damaging 1.00
R4395:Pik3cg UTSW 12 32204092 missense probably damaging 1.00
R4725:Pik3cg UTSW 12 32193597 critical splice donor site probably null
R4785:Pik3cg UTSW 12 32205199 missense probably damaging 0.97
R4809:Pik3cg UTSW 12 32204081 missense possibly damaging 0.46
R4981:Pik3cg UTSW 12 32204104 missense possibly damaging 0.77
R5033:Pik3cg UTSW 12 32199196 splice site probably null
R5161:Pik3cg UTSW 12 32204978 missense possibly damaging 0.92
R5806:Pik3cg UTSW 12 32204953 missense possibly damaging 0.88
R6136:Pik3cg UTSW 12 32204359 missense probably benign 0.00
R6746:Pik3cg UTSW 12 32194758 missense probably damaging 1.00
R6895:Pik3cg UTSW 12 32204347 missense possibly damaging 0.87
R7000:Pik3cg UTSW 12 32192129 missense probably damaging 1.00
R7089:Pik3cg UTSW 12 32176846 missense probably benign 0.00
R7113:Pik3cg UTSW 12 32205667 missense probably damaging 0.98
R7372:Pik3cg UTSW 12 32197197 missense probably damaging 1.00
R7483:Pik3cg UTSW 12 32195648 missense probably damaging 0.99
R7596:Pik3cg UTSW 12 32204741 missense probably damaging 1.00
R7771:Pik3cg UTSW 12 32204014 missense probably benign
R7910:Pik3cg UTSW 12 32200517 missense probably benign 0.16
R7991:Pik3cg UTSW 12 32200517 missense probably benign 0.16
Z1176:Pik3cg UTSW 12 32204795 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGTACCTCTTCTGCGAAGG -3'
(R):5'- TTTGTGGCCGCGATGAGTAC -3'

Sequencing Primer
(F):5'- CAGAGGACTTGTTGCCCGTG -3'
(R):5'- CGCGATGAGTACCTGGTG -3'
Posted On2019-06-07