Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4472001:Gcnt2'

555881

Institutional Source

Beutler Lab

Gene Symbol

Gcnt2

Ensembl Gene

ENSMUSG00000021360

Gene Name

glucosaminyl (N-acetyl) transferase 2, I-branching enzyme

Synonyms

IGnTB, IGnT, IGnTA, IGnTC, 5330430K10Rik

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.083) question?

Stock #

PIT4472001 (G1)

Quality Score

210.009

Status

Not validated

Chromosome

Chromosomal Location

40859754-40960892 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 40917937 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 19 (V19M)

Ref Sequence

ENSEMBL: ENSMUSP00000066467 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067778] [ENSMUST00000069958] [ENSMUST00000110191] [ENSMUST00000225759]

AlphaFold

P97402

Predicted Effect

probably benign
Transcript: ENSMUST00000067778
AA Change: V19M

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000066467
Gene: ENSMUSG00000021360
AA Change: V19M

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
Pfam:Branch	95	357	4.2e-58	PFAM
low complexity region	377	386	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000069958

SMART Domains

Protein: ENSMUSP00000070942
Gene: ENSMUSG00000021360

Domain	Start	End	E-Value	Type
low complexity region	8	21	N/A	INTRINSIC
Pfam:Branch	95	357	8.4e-60	PFAM
low complexity region	377	386	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110191

SMART Domains

Protein: ENSMUSP00000105820
Gene: ENSMUSG00000021360

Domain	Start	End	E-Value	Type
transmembrane domain	7	24	N/A	INTRINSIC
Pfam:Branch	95	357	5.2e-61	PFAM
low complexity region	377	386	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000225759
AA Change: V19M

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)

Coding Region Coverage

1x: 93.7%
3x: 90.8%
10x: 84.2%
20x: 70.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme responsible for formation of the blood group I antigen. The i and I antigens are distinguished by linear and branched poly-N-acetyllactosaminoglycans, respectively. The encoded protein is the I-branching enzyme, a beta-1,6-N-acetylglucosaminyltransferase responsible for the conversion of fetal i antigen to adult I antigen in erythrocytes during embryonic development. Mutations in this gene have been associated with adult i blood group phenotype. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show hypoactivity, a reduced B cell number, epidermoid cyst formation in male abdominal skin, and impaired renal function with increased blood urea nitrogen and creatinine levels and vacuolization of renal tubular epithelial cells in aging mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A4gnt	C	A	9: 99,620,560	P258T	probably damaging	Het
Arvcf	T	C	16: 18,402,949	V714A	possibly damaging	Het
Bcas3	A	G	11: 85,531,900	I532V	probably damaging	Het
Cbr1	T	A	16: 93,609,804	V136E	probably damaging	Het
Ccdc27	T	C	4: 154,041,727	M102V	unknown	Het
Ccr1	T	C	9: 123,963,728	Y255C	probably damaging	Het
Cd300e	T	A	11: 115,054,510	I153F	possibly damaging	Het
Chd7	C	T	4: 8,753,101	L533F	unknown	Het
Cpvl	A	T	6: 53,896,479	F424Y	possibly damaging	Het
Cxcl16	C	T	11: 70,458,799	G80R	probably damaging	Het
Cyp2g1	T	C	7: 26,814,194	V186A	probably benign	Het
Cyp4f15	T	A	17: 32,702,824	M490K	probably damaging	Het
D630045J12Rik	A	T	6: 38,178,839	V1160D	probably damaging	Het
Fbn1	T	C	2: 125,306,501	D2609G	possibly damaging	Het
Fgf5	T	A	5: 98,261,979	V129E	probably damaging	Het
Fhl5	C	A	4: 25,211,194	C166F	probably damaging	Het
Frem1	G	A	4: 82,972,137	T1035I	probably benign	Het
Gga1	C	A	15: 78,893,636	A595D	probably damaging	Het
Gpaa1	C	T	15: 76,334,740	T594I	probably benign	Het
Gskip	C	T	12: 105,684,862		probably benign	Het
Ighv1-72	A	G	12: 115,758,000	V112A	probably damaging	Het
Krt16	T	A	11: 100,247,906	T185S	probably benign	Het
Lama1	T	C	17: 67,764,704	V862A		Het
Lats2	A	C	14: 57,699,357	Y558*	probably null	Het
Mast4	G	A	13: 102,804,718	T277M	probably damaging	Het
Mnx1	T	C	5: 29,474,107	E326G	unknown	Het
Mtmr10	A	G	7: 64,333,358	E471G	probably benign	Het
Olfr488	C	T	7: 108,256,103	V12M	possibly damaging	Het
Otog	G	A	7: 46,295,849	V2177M	probably damaging	Het
Ovgp1	A	G	3: 105,986,990	E693G	unknown	Het
Pclo	T	C	5: 14,713,168	M600T	possibly damaging	Het
Pdgfra	T	A	5: 75,180,246	M622K	probably damaging	Het
Pdxdc1	A	G	16: 13,845,345	L428P	probably damaging	Het
Pfkfb4	T	C	9: 108,999,154	Y86H	probably benign	Het
Pik3cg	A	G	12: 32,204,984	Y335H	probably damaging	Het
Podnl1	G	A	8: 84,127,848	V150M		Het
Pou4f3	A	G	18: 42,394,652	M4V	probably benign	Het
Ppp1r13b	G	A	12: 111,832,640	R864C	probably damaging	Het
R3hdm4	A	G	10: 79,913,555		probably null	Het
Skil	T	A	3: 31,098,232	V301D	probably damaging	Het
Sptb	G	A	12: 76,620,686	T879M	probably damaging	Het
St5	G	A	7: 109,531,130	A888V	probably damaging	Het
Strip1	G	A	3: 107,628,170	A79V	probably benign	Het
Tpgs2	G	A	18: 25,168,595	T5M	possibly damaging	Het
Trim34a	T	A	7: 104,247,948	L73Q	probably damaging	Het
Trpv4	T	A	5: 114,626,923	T677S	probably damaging	Het
Vmn2r23	A	G	6: 123,712,977	T271A	possibly damaging	Het

Other mutations in Gcnt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01523:Gcnt2	APN	13	40887863	missense	probably benign	0.06
IGL01693:Gcnt2	APN	13	40888073	missense	probably benign
IGL02506:Gcnt2	APN	13	40887380	missense	probably benign	0.02
IGL03184:Gcnt2	APN	13	40888184	missense	probably benign	0.01
BB001:Gcnt2	UTSW	13	40918564	nonsense	probably null
BB011:Gcnt2	UTSW	13	40918564	nonsense	probably null
R0358:Gcnt2	UTSW	13	40860853	missense	probably damaging	0.99
R0734:Gcnt2	UTSW	13	40860521	missense	probably benign	0.00
R1863:Gcnt2	UTSW	13	40861101	missense	possibly damaging	0.95
R3103:Gcnt2	UTSW	13	40918606	missense	probably benign	0.00
R3156:Gcnt2	UTSW	13	40861178	missense	probably benign	0.36
R3893:Gcnt2	UTSW	13	40860446	missense	probably benign	0.14
R4134:Gcnt2	UTSW	13	40887807	missense	probably damaging	1.00
R4135:Gcnt2	UTSW	13	40887807	missense	probably damaging	1.00
R4279:Gcnt2	UTSW	13	40888190	missense	probably benign	0.17
R4422:Gcnt2	UTSW	13	40860525	nonsense	probably null
R4599:Gcnt2	UTSW	13	40887490	missense	probably benign
R4618:Gcnt2	UTSW	13	40958194	nonsense	probably null
R4908:Gcnt2	UTSW	13	40860734	missense	probably damaging	1.00
R5123:Gcnt2	UTSW	13	40918355	missense	probably damaging	0.99
R5291:Gcnt2	UTSW	13	40918792	missense	probably damaging	1.00
R5437:Gcnt2	UTSW	13	40861176	missense	probably damaging	1.00
R5463:Gcnt2	UTSW	13	40918174	missense	possibly damaging	0.80
R5471:Gcnt2	UTSW	13	40860719	missense	probably damaging	1.00
R5472:Gcnt2	UTSW	13	40953579	missense	probably benign	0.30
R5493:Gcnt2	UTSW	13	40953600	missense	possibly damaging	0.70
R5586:Gcnt2	UTSW	13	40860953	missense	probably damaging	1.00
R5695:Gcnt2	UTSW	13	40918199	missense	probably benign	0.03
R6244:Gcnt2	UTSW	13	40861241	missense	probably damaging	1.00
R6293:Gcnt2	UTSW	13	40918697	missense	probably damaging	1.00
R7036:Gcnt2	UTSW	13	40887556	frame shift	probably null
R7077:Gcnt2	UTSW	13	40860420	missense	probably benign
R7432:Gcnt2	UTSW	13	40887212	intron	probably benign
R7474:Gcnt2	UTSW	13	40958257	missense	probably damaging	1.00
R7508:Gcnt2	UTSW	13	40887681	missense	probably benign	0.02
R7599:Gcnt2	UTSW	13	40860867	nonsense	probably null
R7678:Gcnt2	UTSW	13	40953719	missense	probably benign	0.01
R7806:Gcnt2	UTSW	13	40918241	missense	probably damaging	1.00
R7808:Gcnt2	UTSW	13	40860862	missense	possibly damaging	0.81
R7909:Gcnt2	UTSW	13	40860450	missense	probably benign	0.00
R7924:Gcnt2	UTSW	13	40918564	nonsense	probably null
R8110:Gcnt2	UTSW	13	40917722	start gained	probably benign
R8287:Gcnt2	UTSW	13	40860632	missense	probably damaging	1.00
R8782:Gcnt2	UTSW	13	40918753	missense	probably damaging	0.98
R8956:Gcnt2	UTSW	13	40887728	missense	probably benign	0.30
R9225:Gcnt2	UTSW	13	40860860	missense	probably damaging	1.00
R9357:Gcnt2	UTSW	13	40888256	missense	possibly damaging	0.92
Z1088:Gcnt2	UTSW	13	40918639	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCTAAACTCCAGCCAGTCC -3'
(R):5'- TATTGAGGACAGGAGAGTCTTTC -3'

Sequencing Primer
(F):5'- AGACCCACGCCTTGAGAG -3'
(R):5'- CAGGAGAGTCTTTCTAAAGGATGTG -3'

Posted On

2019-06-07