Mutagenetix > Incidental Mutations

Incidental Mutation 'PIT4472001:Lats2'

555883

Institutional Source

Beutler Lab

Gene Symbol

Lats2

Ensembl Gene

ENSMUSG00000021959

Gene Name

large tumor suppressor 2

Synonyms

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

PIT4472001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

57689662-57758388 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to C at 57699357 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 558 (Y558*)

Ref Sequence

ENSEMBL: ENSMUSP00000022531 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022531] [ENSMUST00000173964] [ENSMUST00000173990] [ENSMUST00000174166] [ENSMUST00000174213] [ENSMUST00000174694]

PDB Structure

Solution structure of RSGI RUH-038, a UBA domain from Mouse LATS2 (Large Tumor Suppressor homolog 2) [SOLUTION NMR]

Predicted Effect

probably null
Transcript: ENSMUST00000022531
AA Change: Y558*

SMART Domains

Protein: ENSMUSP00000022531
Gene: ENSMUSG00000021959
AA Change: Y558*

Domain	Start	End	E-Value	Type
PDB:2COS\|A	91	138	3e-20	PDB
low complexity region	210	223	N/A	INTRINSIC
low complexity region	401	408	N/A	INTRINSIC
low complexity region	437	444	N/A	INTRINSIC
low complexity region	471	482	N/A	INTRINSIC
low complexity region	517	529	N/A	INTRINSIC
S_TKc	626	931	2.94e-94	SMART
S_TK_X	932	1002	1.21e-3	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000173964
AA Change: Y178*

SMART Domains

Protein: ENSMUSP00000134142
Gene: ENSMUSG00000021959
AA Change: Y178*

Domain	Start	End	E-Value	Type
low complexity region	21	28	N/A	INTRINSIC
low complexity region	57	64	N/A	INTRINSIC
low complexity region	91	102	N/A	INTRINSIC
low complexity region	137	149	N/A	INTRINSIC
Pfam:Pkinase	233	288	2.3e-5	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000173990
AA Change: Y558*

SMART Domains

Protein: ENSMUSP00000133976
Gene: ENSMUSG00000021959
AA Change: Y558*

Domain	Start	End	E-Value	Type
PDB:2COS\|A	91	138	8e-22	PDB
low complexity region	210	223	N/A	INTRINSIC
low complexity region	401	408	N/A	INTRINSIC
low complexity region	437	444	N/A	INTRINSIC
low complexity region	471	482	N/A	INTRINSIC
low complexity region	517	529	N/A	INTRINSIC
S_TKc	626	893	7.75e-71	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000174166

SMART Domains

Protein: ENSMUSP00000133379
Gene: ENSMUSG00000021959

Domain	Start	End	E-Value	Type
PDB:2COS\|A	91	114	5e-7	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000174213

SMART Domains

Protein: ENSMUSP00000134321
Gene: ENSMUSG00000021959

Domain	Start	End	E-Value	Type
PDB:2COS\|A	91	114	2e-6	PDB

Predicted Effect

probably null
Transcript: ENSMUST00000174694
AA Change: Y558*

SMART Domains

Protein: ENSMUSP00000133680
Gene: ENSMUSG00000114942
AA Change: Y558*

Domain	Start	End	E-Value	Type
PDB:2COS\|A	91	138	7e-22	PDB
low complexity region	210	223	N/A	INTRINSIC
low complexity region	401	408	N/A	INTRINSIC
low complexity region	437	444	N/A	INTRINSIC
low complexity region	471	482	N/A	INTRINSIC
low complexity region	517	529	N/A	INTRINSIC
Pfam:Pkinase	626	792	2.2e-38	PFAM
Pfam:Pkinase_Tyr	626	795	2.8e-21	PFAM

Coding Region Coverage

1x: 93.7%
3x: 90.8%
10x: 84.2%
20x: 70.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase belonging to the LATS tumor suppressor family. The protein localizes to centrosomes during interphase, and early and late metaphase. It interacts with the centrosomal proteins aurora-A and ajuba and is required for accumulation of gamma-tubulin and spindle formation at the onset of mitosis. It also interacts with a negative regulator of p53 and may function in a positive feedback loop with p53 that responds to cytoskeleton damage. Additionally, it can function as a co-repressor of androgen-responsive gene expression. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality with decreased cell proliferation, chromosomal instability, atrial hyperplasia, ventricular hypoplasia, delayed embryonic development, an irregular kinked neural tube, and hemorrhages. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A4gnt	C	A	9: 99,620,560	P258T	probably damaging	Het
Arvcf	T	C	16: 18,402,949	V714A	possibly damaging	Het
Bcas3	A	G	11: 85,531,900	I532V	probably damaging	Het
Cbr1	T	A	16: 93,609,804	V136E	probably damaging	Het
Ccdc27	T	C	4: 154,041,727	M102V	unknown	Het
Ccr1	T	C	9: 123,963,728	Y255C	probably damaging	Het
Cd300e	T	A	11: 115,054,510	I153F	possibly damaging	Het
Chd7	C	T	4: 8,753,101	L533F	unknown	Het
Cpvl	A	T	6: 53,896,479	F424Y	possibly damaging	Het
Cxcl16	C	T	11: 70,458,799	G80R	probably damaging	Het
Cyp2g1	T	C	7: 26,814,194	V186A	probably benign	Het
Cyp4f15	T	A	17: 32,702,824	M490K	probably damaging	Het
D630045J12Rik	A	T	6: 38,178,839	V1160D	probably damaging	Het
Fbn1	T	C	2: 125,306,501	D2609G	possibly damaging	Het
Fgf5	T	A	5: 98,261,979	V129E	probably damaging	Het
Fhl5	C	A	4: 25,211,194	C166F	probably damaging	Het
Frem1	G	A	4: 82,972,137	T1035I	probably benign	Het
Gcnt2	G	A	13: 40,917,937	V19M	probably benign	Het
Gga1	C	A	15: 78,893,636	A595D	probably damaging	Het
Gpaa1	C	T	15: 76,334,740	T594I	probably benign	Het
Gskip	C	T	12: 105,684,862		probably benign	Het
Ighv1-72	A	G	12: 115,758,000	V112A	probably damaging	Het
Krt16	T	A	11: 100,247,906	T185S	probably benign	Het
Lama1	T	C	17: 67,764,704	V862A		Het
Mast4	G	A	13: 102,804,718	T277M	probably damaging	Het
Mnx1	T	C	5: 29,474,107	E326G	unknown	Het
Mtmr10	A	G	7: 64,333,358	E471G	probably benign	Het
Olfr488	C	T	7: 108,256,103	V12M	possibly damaging	Het
Otog	G	A	7: 46,295,849	V2177M	probably damaging	Het
Ovgp1	A	G	3: 105,986,990	E693G	unknown	Het
Pclo	T	C	5: 14,713,168	M600T	possibly damaging	Het
Pdgfra	T	A	5: 75,180,246	M622K	probably damaging	Het
Pdxdc1	A	G	16: 13,845,345	L428P	probably damaging	Het
Pfkfb4	T	C	9: 108,999,154	Y86H	probably benign	Het
Pik3cg	A	G	12: 32,204,984	Y335H	probably damaging	Het
Podnl1	G	A	8: 84,127,848	V150M		Het
Pou4f3	A	G	18: 42,394,652	M4V	probably benign	Het
Ppp1r13b	G	A	12: 111,832,640	R864C	probably damaging	Het
R3hdm4	A	G	10: 79,913,555		probably null	Het
Skil	T	A	3: 31,098,232	V301D	probably damaging	Het
Sptb	G	A	12: 76,620,686	T879M	probably damaging	Het
St5	G	A	7: 109,531,130	A888V	probably damaging	Het
Strip1	G	A	3: 107,628,170	A79V	probably benign	Het
Tpgs2	G	A	18: 25,168,595	T5M	possibly damaging	Het
Trim34a	T	A	7: 104,247,948	L73Q	probably damaging	Het
Trpv4	T	A	5: 114,626,923	T677S	probably damaging	Het
Vmn2r23	A	G	6: 123,712,977	T271A	possibly damaging	Het

Other mutations in Lats2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:Lats2	APN	14	57691569	missense	probably benign	0.09
IGL02104:Lats2	APN	14	57734012	missense	probably damaging	1.00
IGL02173:Lats2	APN	14	57697260	missense	probably damaging	1.00
IGL02377:Lats2	APN	14	57691595	missense	probably damaging	1.00
IGL02995:Lats2	APN	14	57700348	missense	probably damaging	1.00
R6846_Lats2_781	UTSW	14	57696134	missense	probably damaging	1.00
R0653:Lats2	UTSW	14	57700196	nonsense	probably null
R0780:Lats2	UTSW	14	57691296	missense	probably damaging	1.00
R1129:Lats2	UTSW	14	57700333	missense	possibly damaging	0.71
R1851:Lats2	UTSW	14	57697455	missense	probably damaging	1.00
R1882:Lats2	UTSW	14	57697354	missense	probably damaging	1.00
R2184:Lats2	UTSW	14	57691559	missense	probably damaging	0.99
R3498:Lats2	UTSW	14	57722466	missense	possibly damaging	0.95
R3692:Lats2	UTSW	14	57691541	missense	probably damaging	1.00
R4212:Lats2	UTSW	14	57696255	missense	possibly damaging	0.82
R4357:Lats2	UTSW	14	57699383	missense	probably damaging	1.00
R4962:Lats2	UTSW	14	57699592	missense	probably damaging	1.00
R5394:Lats2	UTSW	14	57691353	missense	probably benign	0.10
R5477:Lats2	UTSW	14	57699553	missense	probably benign	0.00
R5729:Lats2	UTSW	14	57722735	missense	probably benign	0.04
R5802:Lats2	UTSW	14	57694418	missense	probably damaging	0.99
R5931:Lats2	UTSW	14	57696131	missense	probably damaging	1.00
R6016:Lats2	UTSW	14	57734175	missense	probably damaging	1.00
R6376:Lats2	UTSW	14	57722509	missense	probably benign	0.00
R6624:Lats2	UTSW	14	57694312	critical splice donor site	probably null
R6638:Lats2	UTSW	14	57699365	missense	probably damaging	1.00
R6846:Lats2	UTSW	14	57696134	missense	probably damaging	1.00
R7198:Lats2	UTSW	14	57697125	missense	probably damaging	1.00
R7233:Lats2	UTSW	14	57722694	splice site	probably null
R7883:Lats2	UTSW	14	57697200	missense	probably damaging	1.00
R8081:Lats2	UTSW	14	57700511	missense	probably damaging	1.00
R8356:Lats2	UTSW	14	57697410	missense	probably damaging	1.00
R8508:Lats2	UTSW	14	57722705	missense	probably benign	0.08
R8536:Lats2	UTSW	14	57703038	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCACCCCGTGTCTGAGATG -3'
(R):5'- TAAGTCTGAGCAGTACAGCG -3'

Sequencing Primer
(F):5'- CCCGTGTCTGAGATGGGTGC -3'
(R):5'- TCTGAGCAGTACAGCGTGGAC -3'

Posted On

2019-06-07