Mutagenetix > Incidental Mutations

Incidental Mutation 'PIT4458001:Phf3'

555893

Institutional Source

Beutler Lab

Gene Symbol

Phf3

Ensembl Gene

ENSMUSG00000048874

Gene Name

PHD finger protein 3

Synonyms

AU020177, 2310061N19Rik

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

PIT4458001 (G1)

Quality Score

192.009

Status

Not validated

Chromosome

Chromosomal Location

30802339-30873921 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 30816541 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 988 (H988R)

Ref Sequence

ENSEMBL: ENSMUSP00000085650 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088310] [ENSMUST00000186733] [ENSMUST00000191064]

Predicted Effect

probably damaging
Transcript: ENSMUST00000088310
AA Change: H988R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000085650
Gene: ENSMUSG00000048874
AA Change: H988R

Domain	Start	End	E-Value	Type
low complexity region	212	223	N/A	INTRINSIC
low complexity region	337	344	N/A	INTRINSIC
low complexity region	600	611	N/A	INTRINSIC
low complexity region	651	660	N/A	INTRINSIC
PHD	697	748	3.82e-10	SMART
low complexity region	847	859	N/A	INTRINSIC
low complexity region	876	887	N/A	INTRINSIC
TFS2M	908	1008	1.28e-47	SMART
Pfam:SPOC	1188	1294	4.2e-26	PFAM
low complexity region	1367	1373	N/A	INTRINSIC
low complexity region	1516	1529	N/A	INTRINSIC
low complexity region	1597	1620	N/A	INTRINSIC
low complexity region	1796	1811	N/A	INTRINSIC
low complexity region	1813	1846	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000186733
AA Change: H988R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139610
Gene: ENSMUSG00000048874
AA Change: H988R

Domain	Start	End	E-Value	Type
low complexity region	212	223	N/A	INTRINSIC
low complexity region	337	344	N/A	INTRINSIC
low complexity region	600	611	N/A	INTRINSIC
low complexity region	651	660	N/A	INTRINSIC
PHD	697	748	3.82e-10	SMART
low complexity region	847	859	N/A	INTRINSIC
low complexity region	876	887	N/A	INTRINSIC
TFS2M	908	1008	1.28e-47	SMART
Pfam:SPOC	1188	1294	4.2e-26	PFAM
low complexity region	1367	1373	N/A	INTRINSIC
low complexity region	1516	1529	N/A	INTRINSIC
low complexity region	1597	1620	N/A	INTRINSIC
low complexity region	1796	1811	N/A	INTRINSIC
low complexity region	1813	1846	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000191064

Coding Region Coverage

1x: 93.1%
3x: 90.8%
10x: 85.3%
20x: 73.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a PHD finger-containing gene family. This gene may function as a transcription factor and may be involved in glioblastomas development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	G	T	11: 9,298,304	V2684L	probably benign	Het
Adamts9	T	A	6: 92,889,905	I718F	probably damaging	Het
Adcyap1r1	A	G	6: 55,478,082	D110G	probably benign	Het
Adgrd1	G	A	5: 129,131,577	G281D	probably damaging	Het
Afg1l	A	T	10: 42,454,370	C100*	probably null	Het
Atp2a2	G	A	5: 122,457,309	Q993*	probably null	Het
Baz1a	A	G	12: 54,930,310	M389T	probably benign	Het
Btnl4	T	A	17: 34,474,268	M58L	probably benign	Het
Card6	TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG	TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG	15: 5,098,691		probably benign	Het
Cpeb1	A	T	7: 81,348,432	F533Y	probably damaging	Het
Ctnna1	T	A	18: 35,175,126	N166K	possibly damaging	Het
Ecsit	T	C	9: 22,076,284	H153R	probably damaging	Het
Gbp8	T	C	5: 105,015,089	K480E	probably benign	Het
Glyat	A	T	19: 12,648,009	T66S	probably benign	Het
Gm1110	T	C	9: 26,880,828	Q632R	probably benign	Het
Gm12185	C	T	11: 48,907,911	R585Q	probably damaging	Het
Gm17669	TAA	TAAA	18: 67,562,749		probably null	Het
Gm7489	A	C	15: 53,885,799	E89A	unknown	Het
Grb7	C	T	11: 98,453,829	Q353*	probably null	Het
Ifi207	G	A	1: 173,735,172	T136I	unknown	Het
Ighv3-1	T	C	12: 113,964,604	Y45C	probably benign	Het
Ing5	A	G	1: 93,811,946	M92V	possibly damaging	Het
Ivl	TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG	TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG	3: 92,572,301		probably benign	Het
Kdm6b	A	T	11: 69,399,952	D1630E	unknown	Het
Lmo7	C	T	14: 101,887,487	Q583*	probably null	Het
Lrrc37a	T	C	11: 103,504,512	D29G	probably benign	Het
Mpdz	G	T	4: 81,419,026	A10D	probably damaging	Het
Myh4	A	G	11: 67,240,995	M94V	possibly damaging	Het
Nectin2	A	C	7: 19,738,327	L46V	probably benign	Het
Nynrin	A	T	14: 55,863,968	T365S	probably benign	Het
Olfr1225	A	T	2: 89,170,633	I193K	probably benign	Het
Pde4b	A	C	4: 102,602,678	E570A	probably damaging	Het
Ppfia2	A	G	10: 106,927,847	K1234E	probably benign	Het
Prl7c1	A	T	13: 27,773,758	M233K	probably benign	Het
Prp2	C	T	6: 132,600,547	P266S	unknown	Het
Ralgds	T	C	2: 28,542,474	L160P	probably damaging	Het
Rasa1	A	T	13: 85,227,118	M664K	possibly damaging	Het
Ryr2	T	C	13: 11,555,448	T4930A	probably benign	Het
Senp8	T	C	9: 59,737,480	Y131C	probably damaging	Het
Sp100	A	G	1: 85,708,116	I547M	probably benign	Het
Spata20	A	G	11: 94,484,608	M120T	probably damaging	Het
Spata31	A	G	13: 64,921,850	H604R	probably benign	Het
Sycp1	A	T	3: 102,934,833	S53T	probably benign	Het
Tgm1	T	C	14: 55,712,565	D62G	unknown	Het
Trpm1	G	C	7: 64,268,561	E1434Q	possibly damaging	Het
Tshb	A	T	3: 102,778,164	Y50N	probably damaging	Het
Wdr17	A	T	8: 54,673,579	Y413*	probably null	Het
Zdhhc16	G	A	19: 41,937,770	G55R	possibly damaging	Het

Other mutations in Phf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Phf3	APN	1	30811847	missense	probably damaging	0.99
IGL00704:Phf3	APN	1	30804838	missense	probably benign
IGL01147:Phf3	APN	1	30804169	missense	probably damaging	1.00
IGL01360:Phf3	APN	1	30808728	missense	probably damaging	1.00
IGL01376:Phf3	APN	1	30830485	missense	possibly damaging	0.62
IGL01396:Phf3	APN	1	30804305	nonsense	probably null
IGL01830:Phf3	APN	1	30814067	nonsense	probably null
IGL02108:Phf3	APN	1	30829951	missense	probably damaging	1.00
IGL02156:Phf3	APN	1	30808778	missense	probably damaging	1.00
IGL02576:Phf3	APN	1	30830036	missense	probably benign	0.01
IGL03031:Phf3	APN	1	30804653	missense	probably benign	0.00
IGL03334:Phf3	APN	1	30805729	missense	probably damaging	0.99
IGL03411:Phf3	APN	1	30804401	missense	probably damaging	1.00
FR4976:Phf3	UTSW	1	30805023	utr 3 prime	probably benign
R0037:Phf3	UTSW	1	30804918	missense	probably benign	0.03
R0052:Phf3	UTSW	1	30808767	missense	probably damaging	1.00
R0114:Phf3	UTSW	1	30805443	missense	possibly damaging	0.87
R0123:Phf3	UTSW	1	30805065	missense	probably benign	0.01
R0225:Phf3	UTSW	1	30805065	missense	probably benign	0.01
R0715:Phf3	UTSW	1	30811838	missense	probably damaging	1.00
R0835:Phf3	UTSW	1	30830551	missense	probably benign	0.02
R0848:Phf3	UTSW	1	30863172	missense	probably damaging	1.00
R1473:Phf3	UTSW	1	30805940	missense	probably damaging	1.00
R1522:Phf3	UTSW	1	30805648	missense	probably benign	0.05
R1549:Phf3	UTSW	1	30804842	missense	probably benign	0.00
R1555:Phf3	UTSW	1	30805877	missense	possibly damaging	0.86
R1780:Phf3	UTSW	1	30811942	missense	probably damaging	1.00
R1789:Phf3	UTSW	1	30806206	missense	probably damaging	1.00
R1875:Phf3	UTSW	1	30830623	missense	possibly damaging	0.81
R1912:Phf3	UTSW	1	30804345	missense	probably damaging	1.00
R1957:Phf3	UTSW	1	30831520	missense	probably damaging	1.00
R2019:Phf3	UTSW	1	30811847	missense	probably damaging	0.99
R2259:Phf3	UTSW	1	30804343	missense	probably benign	0.20
R2305:Phf3	UTSW	1	30805475	nonsense	probably null
R2345:Phf3	UTSW	1	30805351	nonsense	probably null
R2424:Phf3	UTSW	1	30806349	missense	probably damaging	1.00
R2497:Phf3	UTSW	1	30830014	missense	probably damaging	1.00
R2504:Phf3	UTSW	1	30810789	missense	probably damaging	1.00
R3522:Phf3	UTSW	1	30805603	missense	probably damaging	1.00
R3816:Phf3	UTSW	1	30805753	missense	probably damaging	1.00
R4152:Phf3	UTSW	1	30831458	missense	probably benign	0.13
R4403:Phf3	UTSW	1	30804409	missense	probably damaging	1.00
R4658:Phf3	UTSW	1	30863088	missense	probably damaging	1.00
R4663:Phf3	UTSW	1	30821215	missense	probably damaging	1.00
R4669:Phf3	UTSW	1	30829946	missense	probably damaging	1.00
R4706:Phf3	UTSW	1	30805606	missense	probably damaging	1.00
R4757:Phf3	UTSW	1	30820827	missense	probably damaging	1.00
R4766:Phf3	UTSW	1	30813939	unclassified	probably benign
R4786:Phf3	UTSW	1	30816557	nonsense	probably null
R5107:Phf3	UTSW	1	30831485	missense	probably benign	0.03
R5155:Phf3	UTSW	1	30824376	missense	possibly damaging	0.87
R5310:Phf3	UTSW	1	30803806	missense	probably damaging	1.00
R5823:Phf3	UTSW	1	30804683	missense	probably damaging	1.00
R5944:Phf3	UTSW	1	30820704	missense	probably damaging	1.00
R5979:Phf3	UTSW	1	30805746	missense	probably damaging	1.00
R6007:Phf3	UTSW	1	30804345	missense	probably damaging	1.00
R6024:Phf3	UTSW	1	30863226	missense	probably damaging	1.00
R6072:Phf3	UTSW	1	30830688	missense	probably benign	0.08
R6533:Phf3	UTSW	1	30806318	missense	probably damaging	1.00
R6649:Phf3	UTSW	1	30805023	missense	possibly damaging	0.75
R6653:Phf3	UTSW	1	30805023	missense	possibly damaging	0.75
R6852:Phf3	UTSW	1	30804630	missense	probably damaging	0.97
R6855:Phf3	UTSW	1	30820123	missense	probably damaging	1.00
R6862:Phf3	UTSW	1	30813982	missense	probably damaging	1.00
R6930:Phf3	UTSW	1	30811877	missense	probably damaging	1.00
R7135:Phf3	UTSW	1	30831109	missense	possibly damaging	0.61
R7323:Phf3	UTSW	1	30813130	missense	probably benign	0.01
R7352:Phf3	UTSW	1	30804326	missense	possibly damaging	0.87
R7455:Phf3	UTSW	1	30837158	missense	probably damaging	0.96
R7549:Phf3	UTSW	1	30831475	missense	probably benign	0.01
R7609:Phf3	UTSW	1	30805501	missense	probably benign	0.05
R7720:Phf3	UTSW	1	30829857	missense	probably damaging	1.00
R7745:Phf3	UTSW	1	30804224	missense	probably damaging	1.00
R8134:Phf3	UTSW	1	30824471	missense	unknown
R8264:Phf3	UTSW	1	30831057	missense	possibly damaging	0.48
R8545:Phf3	UTSW	1	30824310	missense	possibly damaging	0.48
Z1177:Phf3	UTSW	1	30804295	missense	probably damaging	1.00
Z1177:Phf3	UTSW	1	30805051	missense	unknown
Z1177:Phf3	UTSW	1	30811968	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- AAGAGAATCACCTGGCCCAG -3'
(R):5'- CTGCTAGGCTGTATGTACTAGG -3'

Sequencing Primer
(F):5'- CCAGATCGGGTGGGGTGAG -3'
(R):5'- CCAGGCTTTAAAGTGGCTT -3'

Posted On

2019-06-07