Incidental Mutation 'PIT4458001:Ralgds'
ID555897
Institutional Source Beutler Lab
Gene Symbol Ralgds
Ensembl Gene ENSMUSG00000026821
Gene Nameral guanine nucleotide dissociation stimulator
SynonymsRalGDS, Gnds, Rgds
Accession Numbers

Ncbi RefSeq: NM_001145835.1, NM_001145836.1, NM_009058.2, NM_001145834.1; MGI:107485

Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #PIT4458001 (G1)
Quality Score135.008
Status Not validated
Chromosome2
Chromosomal Location28513125-28553081 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28542474 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 160 (L160P)
Ref Sequence ENSEMBL: ENSMUSP00000097812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028170] [ENSMUST00000100241] [ENSMUST00000113893] [ENSMUST00000135803]
Predicted Effect probably damaging
Transcript: ENSMUST00000028170
AA Change: L105P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028170
Gene: ENSMUSG00000026821
AA Change: L105P

DomainStartEndE-ValueType
RasGEFN 56 194 4.02e-37 SMART
low complexity region 239 285 N/A INTRINSIC
RasGEF 320 587 5.28e-118 SMART
low complexity region 613 626 N/A INTRINSIC
low complexity region 646 655 N/A INTRINSIC
low complexity region 683 712 N/A INTRINSIC
low complexity region 716 726 N/A INTRINSIC
RA 736 823 6.51e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100241
AA Change: L160P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097812
Gene: ENSMUSG00000026821
AA Change: L160P

DomainStartEndE-ValueType
RasGEFN 111 249 4.02e-37 SMART
low complexity region 294 340 N/A INTRINSIC
RasGEF 375 642 5.28e-118 SMART
low complexity region 668 681 N/A INTRINSIC
low complexity region 701 710 N/A INTRINSIC
low complexity region 738 767 N/A INTRINSIC
low complexity region 771 781 N/A INTRINSIC
RA 791 878 6.51e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113893
AA Change: L160P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109526
Gene: ENSMUSG00000026821
AA Change: L160P

DomainStartEndE-ValueType
RasGEFN 111 237 1.25e-42 SMART
low complexity region 282 328 N/A INTRINSIC
RasGEF 363 630 5.28e-118 SMART
low complexity region 656 669 N/A INTRINSIC
low complexity region 689 698 N/A INTRINSIC
low complexity region 726 755 N/A INTRINSIC
low complexity region 759 769 N/A INTRINSIC
RA 779 866 6.51e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000135803
AA Change: L105P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115092
Gene: ENSMUSG00000026821
AA Change: L105P

DomainStartEndE-ValueType
RasGEFN 56 127 2.47e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000137215
AA Change: L47P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116215
Gene: ENSMUSG00000026821
AA Change: L47P

DomainStartEndE-ValueType
RasGEFN 1 107 5.55e-8 SMART
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.8%
  • 10x: 85.3%
  • 20x: 73.0%
Validation Efficiency
MGI Phenotype Strain: 3574574
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Guanine nucleotide dissociation stimulators (GDSs, or exchange factors), such as RALGDS, are effectors of Ras-related GTPases (see MIM 190020) that participate in signaling for a variety of cellular processes.[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous mutant mice exhibit reduced tumor incidence, size and progression to malignancy in multistage skin carcinogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted(5) Gene trapped(11)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G T 11: 9,298,304 V2684L probably benign Het
Adamts9 T A 6: 92,889,905 I718F probably damaging Het
Adcyap1r1 A G 6: 55,478,082 D110G probably benign Het
Adgrd1 G A 5: 129,131,577 G281D probably damaging Het
Afg1l A T 10: 42,454,370 C100* probably null Het
Atp2a2 G A 5: 122,457,309 Q993* probably null Het
Baz1a A G 12: 54,930,310 M389T probably benign Het
Btnl4 T A 17: 34,474,268 M58L probably benign Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cpeb1 A T 7: 81,348,432 F533Y probably damaging Het
Ctnna1 T A 18: 35,175,126 N166K possibly damaging Het
Ecsit T C 9: 22,076,284 H153R probably damaging Het
Gbp8 T C 5: 105,015,089 K480E probably benign Het
Glyat A T 19: 12,648,009 T66S probably benign Het
Gm1110 T C 9: 26,880,828 Q632R probably benign Het
Gm12185 C T 11: 48,907,911 R585Q probably damaging Het
Gm17669 TAA TAAA 18: 67,562,749 probably null Het
Gm7489 A C 15: 53,885,799 E89A unknown Het
Grb7 C T 11: 98,453,829 Q353* probably null Het
Ifi207 G A 1: 173,735,172 T136I unknown Het
Ighv3-1 T C 12: 113,964,604 Y45C probably benign Het
Ing5 A G 1: 93,811,946 M92V possibly damaging Het
Ivl TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 3: 92,572,301 probably benign Het
Kdm6b A T 11: 69,399,952 D1630E unknown Het
Lmo7 C T 14: 101,887,487 Q583* probably null Het
Lrrc37a T C 11: 103,504,512 D29G probably benign Het
Mpdz G T 4: 81,419,026 A10D probably damaging Het
Myh4 A G 11: 67,240,995 M94V possibly damaging Het
Nectin2 A C 7: 19,738,327 L46V probably benign Het
Nynrin A T 14: 55,863,968 T365S probably benign Het
Olfr1225 A T 2: 89,170,633 I193K probably benign Het
Pde4b A C 4: 102,602,678 E570A probably damaging Het
Phf3 T C 1: 30,816,541 H988R probably damaging Het
Ppfia2 A G 10: 106,927,847 K1234E probably benign Het
Prl7c1 A T 13: 27,773,758 M233K probably benign Het
Prp2 C T 6: 132,600,547 P266S unknown Het
Rasa1 A T 13: 85,227,118 M664K possibly damaging Het
Ryr2 T C 13: 11,555,448 T4930A probably benign Het
Senp8 T C 9: 59,737,480 Y131C probably damaging Het
Sp100 A G 1: 85,708,116 I547M probably benign Het
Spata20 A G 11: 94,484,608 M120T probably damaging Het
Spata31 A G 13: 64,921,850 H604R probably benign Het
Sycp1 A T 3: 102,934,833 S53T probably benign Het
Tgm1 T C 14: 55,712,565 D62G unknown Het
Trpm1 G C 7: 64,268,561 E1434Q possibly damaging Het
Tshb A T 3: 102,778,164 Y50N probably damaging Het
Wdr17 A T 8: 54,673,579 Y413* probably null Het
Zdhhc16 G A 19: 41,937,770 G55R possibly damaging Het
Other mutations in Ralgds
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Ralgds APN 2 28552218 missense probably damaging 1.00
IGL01774:Ralgds APN 2 28550542 nonsense probably null
IGL02747:Ralgds APN 2 28548110 unclassified probably benign
IGL03135:Ralgds APN 2 28549088 missense probably damaging 0.99
PIT4531001:Ralgds UTSW 2 28545214 nonsense probably null
R0049:Ralgds UTSW 2 28542379 synonymous silent
R0052:Ralgds UTSW 2 28544388 critical splice donor site probably null
R0052:Ralgds UTSW 2 28544388 critical splice donor site probably null
R0285:Ralgds UTSW 2 28550569 splice site probably null
R0665:Ralgds UTSW 2 28545206 missense probably damaging 0.98
R0718:Ralgds UTSW 2 28549116 missense probably benign 0.37
R1755:Ralgds UTSW 2 28550546 missense probably damaging 0.99
R1966:Ralgds UTSW 2 28545875 missense probably damaging 0.96
R2873:Ralgds UTSW 2 28548769 splice site probably null
R2874:Ralgds UTSW 2 28548769 splice site probably null
R4082:Ralgds UTSW 2 28552271 utr 3 prime probably benign
R4342:Ralgds UTSW 2 28552095 missense probably damaging 1.00
R4344:Ralgds UTSW 2 28552095 missense probably damaging 1.00
R4647:Ralgds UTSW 2 28545520 critical splice donor site probably null
R4738:Ralgds UTSW 2 28545416 missense probably damaging 1.00
R4762:Ralgds UTSW 2 28552152 missense probably damaging 0.97
R5027:Ralgds UTSW 2 28552090 critical splice acceptor site probably null
R5320:Ralgds UTSW 2 28545212 missense probably damaging 1.00
R5738:Ralgds UTSW 2 28542526 intron probably benign
R5969:Ralgds UTSW 2 28542414 missense probably damaging 1.00
R6014:Ralgds UTSW 2 28543661 missense probably damaging 0.97
R6136:Ralgds UTSW 2 28550565 critical splice donor site probably null
R6137:Ralgds UTSW 2 28547588 missense probably damaging 0.99
R6583:Ralgds UTSW 2 28533644 missense probably damaging 0.99
R6618:Ralgds UTSW 2 28550511 missense probably benign 0.09
R6801:Ralgds UTSW 2 28548436 missense probably damaging 1.00
R7046:Ralgds UTSW 2 28540729 missense probably damaging 1.00
R7095:Ralgds UTSW 2 28549308 missense possibly damaging 0.83
R7276:Ralgds UTSW 2 28545872 missense probably damaging 1.00
R7399:Ralgds UTSW 2 28543655 missense possibly damaging 0.95
R7446:Ralgds UTSW 2 28545889 missense probably damaging 0.99
R7560:Ralgds UTSW 2 28547595 missense probably damaging 1.00
X0028:Ralgds UTSW 2 28548699 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCGGCTCTGAACCTCTATG -3'
(R):5'- TCTCTCAGTCGATTACCACAGGG -3'

Sequencing Primer
(F):5'- TGAACCTCTATGAGACCTGCAAGG -3'
(R):5'- ATTACCACAGGGCCGTCCTTG -3'
Posted On2019-06-07