Incidental Mutation 'PIT4458001:Adgrd1'
ID 555906
Institutional Source Beutler Lab
Gene Symbol Adgrd1
Ensembl Gene ENSMUSG00000044017
Gene Name adhesion G protein-coupled receptor D1
Synonyms E230012M21Rik, Gpr133
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # PIT4458001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 129096750-129204599 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 129131577 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 281 (G281D)
Ref Sequence ENSEMBL: ENSMUSP00000060307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056617] [ENSMUST00000156437]
AlphaFold Q80T32
Predicted Effect probably damaging
Transcript: ENSMUST00000056617
AA Change: G281D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060307
Gene: ENSMUSG00000044017
AA Change: G281D

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Laminin_G_3 119 273 2.9e-18 PFAM
Pfam:Pentaxin 171 288 2.2e-7 PFAM
GPS 535 585 1.57e-14 SMART
Pfam:Dicty_CAR 590 856 1.2e-8 PFAM
Pfam:7tm_2 592 831 8e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000156437
AA Change: G249D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121217
Gene: ENSMUSG00000044017
AA Change: G249D

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.8%
  • 10x: 85.3%
  • 20x: 73.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The adhesion G-protein-coupled receptors (GPCRs), including GPR133, are membrane-bound proteins with long N termini containing multiple domains. GPCRs, or GPRs, contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins (summary by Bjarnadottir et al., 2004 [PubMed 15203201]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G T 11: 9,298,304 V2684L probably benign Het
Adamts9 T A 6: 92,889,905 I718F probably damaging Het
Adcyap1r1 A G 6: 55,478,082 D110G probably benign Het
Afg1l A T 10: 42,454,370 C100* probably null Het
Atp2a2 G A 5: 122,457,309 Q993* probably null Het
Baz1a A G 12: 54,930,310 M389T probably benign Het
Btnl4 T A 17: 34,474,268 M58L probably benign Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cpeb1 A T 7: 81,348,432 F533Y probably damaging Het
Ctnna1 T A 18: 35,175,126 N166K possibly damaging Het
Ecsit T C 9: 22,076,284 H153R probably damaging Het
Gbp8 T C 5: 105,015,089 K480E probably benign Het
Glyat A T 19: 12,648,009 T66S probably benign Het
Gm1110 T C 9: 26,880,828 Q632R probably benign Het
Gm12185 C T 11: 48,907,911 R585Q probably damaging Het
Gm17669 TAA TAAA 18: 67,562,749 probably null Het
Gm7489 A C 15: 53,885,799 E89A unknown Het
Grb7 C T 11: 98,453,829 Q353* probably null Het
Ifi207 G A 1: 173,735,172 T136I unknown Het
Ighv3-1 T C 12: 113,964,604 Y45C probably benign Het
Ing5 A G 1: 93,811,946 M92V possibly damaging Het
Ivl TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 3: 92,572,301 probably benign Het
Kdm6b A T 11: 69,399,952 D1630E unknown Het
Lmo7 C T 14: 101,887,487 Q583* probably null Het
Lrrc37a T C 11: 103,504,512 D29G probably benign Het
Mpdz G T 4: 81,419,026 A10D probably damaging Het
Myh4 A G 11: 67,240,995 M94V possibly damaging Het
Nectin2 A C 7: 19,738,327 L46V probably benign Het
Nynrin A T 14: 55,863,968 T365S probably benign Het
Olfr1225 A T 2: 89,170,633 I193K probably benign Het
Pde4b A C 4: 102,602,678 E570A probably damaging Het
Phf3 T C 1: 30,816,541 H988R probably damaging Het
Ppfia2 A G 10: 106,927,847 K1234E probably benign Het
Prl7c1 A T 13: 27,773,758 M233K probably benign Het
Prp2 C T 6: 132,600,547 P266S unknown Het
Ralgds T C 2: 28,542,474 L160P probably damaging Het
Rasa1 A T 13: 85,227,118 M664K possibly damaging Het
Ryr2 T C 13: 11,555,448 T4930A probably benign Het
Senp8 T C 9: 59,737,480 Y131C probably damaging Het
Sp100 A G 1: 85,708,116 I547M probably benign Het
Spata20 A G 11: 94,484,608 M120T probably damaging Het
Spata31 A G 13: 64,921,850 H604R probably benign Het
Sycp1 A T 3: 102,934,833 S53T probably benign Het
Tgm1 T C 14: 55,712,565 D62G unknown Het
Trpm1 G C 7: 64,268,561 E1434Q possibly damaging Het
Tshb A T 3: 102,778,164 Y50N probably damaging Het
Wdr17 A T 8: 54,673,579 Y413* probably null Het
Zdhhc16 G A 19: 41,937,770 G55R possibly damaging Het
Other mutations in Adgrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Adgrd1 APN 5 129139592 missense probably benign 0.06
IGL01384:Adgrd1 APN 5 129097209 missense possibly damaging 0.47
IGL01636:Adgrd1 APN 5 129142452 splice site probably benign
IGL01916:Adgrd1 APN 5 129132838 missense probably benign 0.12
IGL01923:Adgrd1 APN 5 129178079 missense possibly damaging 0.58
IGL02019:Adgrd1 APN 5 129115138 missense probably benign 0.00
IGL02142:Adgrd1 APN 5 129131584 missense probably benign
IGL02149:Adgrd1 APN 5 129179261 missense probably damaging 1.00
IGL02190:Adgrd1 APN 5 129140724 splice site probably benign
IGL02623:Adgrd1 APN 5 129132745 missense probably damaging 0.99
IGL02696:Adgrd1 APN 5 129140854 splice site probably benign
IGL02850:Adgrd1 APN 5 129115055 missense probably damaging 1.00
IGL02976:Adgrd1 APN 5 129131597 missense probably benign 0.00
IGL02988:Adgrd1 UTSW 5 129144010 missense probably benign 0.00
R0081:Adgrd1 UTSW 5 129178082 missense probably damaging 0.99
R0266:Adgrd1 UTSW 5 129139594 missense probably benign 0.00
R0267:Adgrd1 UTSW 5 129139594 missense probably benign 0.00
R0464:Adgrd1 UTSW 5 129162650 missense probably damaging 1.00
R0625:Adgrd1 UTSW 5 129171931 critical splice donor site probably null
R1288:Adgrd1 UTSW 5 129129007 missense probably damaging 0.97
R1460:Adgrd1 UTSW 5 129122563 missense possibly damaging 0.63
R1635:Adgrd1 UTSW 5 129128907 missense probably damaging 1.00
R1658:Adgrd1 UTSW 5 129178100 missense probably benign 0.02
R1709:Adgrd1 UTSW 5 129179228 missense possibly damaging 0.95
R1897:Adgrd1 UTSW 5 129129001 missense probably benign 0.01
R1976:Adgrd1 UTSW 5 129140797 missense probably benign 0.06
R2049:Adgrd1 UTSW 5 129115095 missense probably benign 0.01
R2259:Adgrd1 UTSW 5 129112311 missense possibly damaging 0.92
R2295:Adgrd1 UTSW 5 129122506 missense probably benign 0.13
R3076:Adgrd1 UTSW 5 129129105 missense probably benign 0.20
R3077:Adgrd1 UTSW 5 129129105 missense probably benign 0.20
R3078:Adgrd1 UTSW 5 129129105 missense probably benign 0.20
R4581:Adgrd1 UTSW 5 129202531 missense possibly damaging 0.68
R5024:Adgrd1 UTSW 5 129171895 missense probably damaging 1.00
R5076:Adgrd1 UTSW 5 129143989 nonsense probably null
R5227:Adgrd1 UTSW 5 129122583 missense probably benign 0.00
R5453:Adgrd1 UTSW 5 129179583 missense probably damaging 0.99
R6349:Adgrd1 UTSW 5 129142539 splice site probably null
R6953:Adgrd1 UTSW 5 129115078 nonsense probably null
R7300:Adgrd1 UTSW 5 129097347 critical splice donor site probably null
R7583:Adgrd1 UTSW 5 129179588 missense probably benign 0.42
R7622:Adgrd1 UTSW 5 129139624 missense probably benign 0.27
R8205:Adgrd1 UTSW 5 129115111 missense possibly damaging 0.94
R8716:Adgrd1 UTSW 5 129188371 missense possibly damaging 0.94
R8780:Adgrd1 UTSW 5 129097074 start gained probably benign
R8850:Adgrd1 UTSW 5 129142510 missense probably benign 0.00
R9528:Adgrd1 UTSW 5 129179676 missense probably benign 0.44
R9569:Adgrd1 UTSW 5 129179637 missense possibly damaging 0.90
R9626:Adgrd1 UTSW 5 129198657 missense probably damaging 1.00
X0067:Adgrd1 UTSW 5 129188352 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GGCTTGCATGAACGGTGTTC -3'
(R):5'- AGGGATGCTTTAATCCTCAGACTC -3'

Sequencing Primer
(F):5'- GAACGGTGTTCAGAAGCAATTTAC -3'
(R):5'- TAATGCATGGAGTAAGAGCCCTTCC -3'
Posted On 2019-06-07