Incidental Mutation 'PIT4458001:Adamts9'
ID 555908
Institutional Source Beutler Lab
Gene Symbol Adamts9
Ensembl Gene ENSMUSG00000030022
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 9
Synonyms Mhdaund3, Mhdaund4, 1810011L16Rik, 8430403M15Rik, E030027K14Rik, Gsfund3, UND3, UND4
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # PIT4458001 (G1)
Quality Score 133.008
Status Not validated
Chromosome 6
Chromosomal Location 92749680-92920473 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 92866886 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 718 (I718F)
Ref Sequence ENSEMBL: ENSMUSP00000109065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113438] [ENSMUST00000167391]
AlphaFold E9PUN6
Predicted Effect probably damaging
Transcript: ENSMUST00000113438
AA Change: I718F

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109065
Gene: ENSMUSG00000030022
AA Change: I718F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 49 207 1.8e-37 PFAM
low complexity region 234 247 N/A INTRINSIC
Pfam:Reprolysin_5 291 476 7.6e-17 PFAM
Pfam:Reprolysin_4 291 495 2e-11 PFAM
Pfam:Reprolysin 293 499 7.4e-29 PFAM
Pfam:Reprolysin_2 310 489 1e-13 PFAM
Pfam:Reprolysin_3 314 445 1.7e-14 PFAM
TSP1 591 643 2.15e-9 SMART
Pfam:ADAM_spacer1 753 871 7.3e-35 PFAM
TSP1 881 936 1.14e0 SMART
Blast:TSP1 938 993 2e-28 BLAST
TSP1 1000 1054 3.78e-5 SMART
TSP1 1055 1109 5.64e-4 SMART
TSP1 1110 1166 1.25e-5 SMART
TSP1 1186 1240 1.45e-6 SMART
TSP1 1242 1296 4.41e-6 SMART
TSP1 1328 1380 7.06e-5 SMART
TSP1 1381 1436 4.24e-8 SMART
TSP1 1440 1495 8.23e-6 SMART
TSP1 1496 1551 1.23e-4 SMART
TSP1 1552 1609 2e-4 SMART
TSP1 1611 1672 1.25e-5 SMART
TSP1 1676 1730 3.47e-4 SMART
Pfam:GON 1732 1930 1.6e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167391
AA Change: I137F

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126498
Gene: ENSMUSG00000030022
AA Change: I137F

DomainStartEndE-ValueType
TSP1 10 62 2.15e-9 SMART
Pfam:ADAM_spacer1 172 290 6.1e-35 PFAM
TSP1 300 355 1.14e0 SMART
Blast:TSP1 357 412 3e-28 BLAST
TSP1 419 473 3.78e-5 SMART
TSP1 474 528 5.64e-4 SMART
TSP1 529 585 1.25e-5 SMART
TSP1 605 659 1.45e-6 SMART
TSP1 661 715 4.41e-6 SMART
TSP1 747 799 7.06e-5 SMART
TSP1 800 855 4.24e-8 SMART
TSP1 859 914 8.23e-6 SMART
TSP1 915 970 1.23e-4 SMART
TSP1 971 1028 2e-4 SMART
TSP1 1030 1091 1.25e-5 SMART
TSP1 1095 1149 3.47e-4 SMART
Pfam:GON 1150 1350 2.1e-86 PFAM
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.8%
  • 10x: 85.3%
  • 20x: 73.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. Members of the ADAMTS family have been implicated in the cleavage of proteoglycans, the control of organ shape during development, and the inhibition of angiogenesis. This gene is localized to chromosome 3p14.3-p14.2, an area known to be lost in hereditary renal tumors. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G T 11: 9,248,304 (GRCm39) V2684L probably benign Het
Adcyap1r1 A G 6: 55,455,067 (GRCm39) D110G probably benign Het
Adgrd1 G A 5: 129,208,641 (GRCm39) G281D probably damaging Het
Afg1l A T 10: 42,330,366 (GRCm39) C100* probably null Het
Atp2a2 G A 5: 122,595,372 (GRCm39) Q993* probably null Het
Baz1a A G 12: 54,977,095 (GRCm39) M389T probably benign Het
Btnl4 T A 17: 34,693,242 (GRCm39) M58L probably benign Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,128,173 (GRCm39) probably benign Het
Cpeb1 A T 7: 80,998,180 (GRCm39) F533Y probably damaging Het
Ctnna1 T A 18: 35,308,179 (GRCm39) N166K possibly damaging Het
Ecsit T C 9: 21,987,580 (GRCm39) H153R probably damaging Het
Gbp8 T C 5: 105,162,955 (GRCm39) K480E probably benign Het
Glyat A T 19: 12,625,373 (GRCm39) T66S probably benign Het
Gm1110 T C 9: 26,792,124 (GRCm39) Q632R probably benign Het
Gm12185 C T 11: 48,798,738 (GRCm39) R585Q probably damaging Het
Gm17669 TAA TAAA 18: 67,695,819 (GRCm39) probably null Het
Gm7489 A C 15: 53,749,195 (GRCm39) E89A unknown Het
Grb7 C T 11: 98,344,655 (GRCm39) Q353* probably null Het
Ifi207 G A 1: 173,562,738 (GRCm39) T136I unknown Het
Ighv3-1 T C 12: 113,928,224 (GRCm39) Y45C probably benign Het
Ing5 A G 1: 93,739,668 (GRCm39) M92V possibly damaging Het
Ivl TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 3: 92,479,608 (GRCm39) probably benign Het
Kdm6b A T 11: 69,290,778 (GRCm39) D1630E unknown Het
Lmo7 C T 14: 102,124,923 (GRCm39) Q583* probably null Het
Lrrc37a T C 11: 103,395,338 (GRCm39) D29G probably benign Het
Mpdz G T 4: 81,337,263 (GRCm39) A10D probably damaging Het
Myh4 A G 11: 67,131,821 (GRCm39) M94V possibly damaging Het
Nectin2 A C 7: 19,472,252 (GRCm39) L46V probably benign Het
Nynrin A T 14: 56,101,425 (GRCm39) T365S probably benign Het
Or4c120 A T 2: 89,000,977 (GRCm39) I193K probably benign Het
Pde4b A C 4: 102,459,875 (GRCm39) E570A probably damaging Het
Phf3 T C 1: 30,855,622 (GRCm39) H988R probably damaging Het
Ppfia2 A G 10: 106,763,708 (GRCm39) K1234E probably benign Het
Prl7c1 A T 13: 27,957,741 (GRCm39) M233K probably benign Het
Prp2 C T 6: 132,577,510 (GRCm39) P266S unknown Het
Ralgds T C 2: 28,432,486 (GRCm39) L160P probably damaging Het
Rasa1 A T 13: 85,375,237 (GRCm39) M664K possibly damaging Het
Ryr2 T C 13: 11,570,334 (GRCm39) T4930A probably benign Het
Senp8 T C 9: 59,644,763 (GRCm39) Y131C probably damaging Het
Sp100 A G 1: 85,635,837 (GRCm39) I547M probably benign Het
Spata20 A G 11: 94,375,434 (GRCm39) M120T probably damaging Het
Spata31 A G 13: 65,069,664 (GRCm39) H604R probably benign Het
Sycp1 A T 3: 102,842,149 (GRCm39) S53T probably benign Het
Tgm1 T C 14: 55,950,022 (GRCm39) D62G unknown Het
Trpm1 G C 7: 63,918,309 (GRCm39) E1434Q possibly damaging Het
Tshb A T 3: 102,685,480 (GRCm39) Y50N probably damaging Het
Wdr17 A T 8: 55,126,614 (GRCm39) Y413* probably null Het
Zdhhc16 G A 19: 41,926,209 (GRCm39) G55R possibly damaging Het
Other mutations in Adamts9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Adamts9 APN 6 92,836,883 (GRCm39) missense possibly damaging 0.90
IGL01352:Adamts9 APN 6 92,837,155 (GRCm39) missense probably benign 0.00
IGL01462:Adamts9 APN 6 92,871,247 (GRCm39) missense probably benign 0.04
IGL01551:Adamts9 APN 6 92,784,001 (GRCm39) missense probably damaging 0.99
IGL01577:Adamts9 APN 6 92,835,128 (GRCm39) splice site probably benign
IGL01638:Adamts9 APN 6 92,849,409 (GRCm39) missense probably benign 0.19
IGL01757:Adamts9 APN 6 92,773,140 (GRCm39) missense probably damaging 1.00
IGL02102:Adamts9 APN 6 92,754,420 (GRCm39) missense probably benign 0.00
IGL02379:Adamts9 APN 6 92,774,014 (GRCm39) missense probably damaging 0.97
IGL02419:Adamts9 APN 6 92,773,978 (GRCm39) missense probably benign 0.04
IGL02554:Adamts9 APN 6 92,857,828 (GRCm39) missense probably benign 0.01
IGL02832:Adamts9 APN 6 92,784,156 (GRCm39) missense probably damaging 1.00
IGL03164:Adamts9 APN 6 92,866,918 (GRCm39) missense probably damaging 1.00
IGL03347:Adamts9 APN 6 92,864,413 (GRCm39) nonsense probably null
IGL03401:Adamts9 APN 6 92,763,849 (GRCm39) missense probably damaging 0.97
basilisk UTSW 6 92,837,170 (GRCm39) missense probably benign 0.35
bluebeard UTSW 6 92,856,940 (GRCm39) nonsense probably null
Serpent UTSW 6 92,885,687 (GRCm39) missense probably damaging 1.00
PIT4402001:Adamts9 UTSW 6 92,849,328 (GRCm39) missense probably benign
R0047:Adamts9 UTSW 6 92,882,287 (GRCm39) unclassified probably benign
R0047:Adamts9 UTSW 6 92,882,287 (GRCm39) unclassified probably benign
R0067:Adamts9 UTSW 6 92,867,148 (GRCm39) missense probably damaging 0.98
R0141:Adamts9 UTSW 6 92,920,066 (GRCm39) missense probably benign
R0326:Adamts9 UTSW 6 92,835,038 (GRCm39) nonsense probably null
R0396:Adamts9 UTSW 6 92,774,986 (GRCm39) missense probably benign 0.00
R0490:Adamts9 UTSW 6 92,849,847 (GRCm39) missense probably benign
R0504:Adamts9 UTSW 6 92,889,626 (GRCm39) missense probably damaging 1.00
R0620:Adamts9 UTSW 6 92,835,094 (GRCm39) missense possibly damaging 0.95
R0669:Adamts9 UTSW 6 92,857,938 (GRCm39) missense probably damaging 1.00
R0682:Adamts9 UTSW 6 92,880,783 (GRCm39) missense possibly damaging 0.80
R1412:Adamts9 UTSW 6 92,773,414 (GRCm39) missense probably benign
R1433:Adamts9 UTSW 6 92,826,271 (GRCm39) critical splice donor site probably null
R1558:Adamts9 UTSW 6 92,885,692 (GRCm39) missense possibly damaging 0.87
R1661:Adamts9 UTSW 6 92,857,604 (GRCm39) missense possibly damaging 0.92
R1801:Adamts9 UTSW 6 92,840,357 (GRCm39) missense probably benign 0.27
R1855:Adamts9 UTSW 6 92,878,350 (GRCm39) splice site probably benign
R1887:Adamts9 UTSW 6 92,849,769 (GRCm39) critical splice donor site probably null
R1934:Adamts9 UTSW 6 92,920,102 (GRCm39) missense possibly damaging 0.59
R1956:Adamts9 UTSW 6 92,836,830 (GRCm39) missense probably damaging 1.00
R1986:Adamts9 UTSW 6 92,773,375 (GRCm39) missense probably benign
R2370:Adamts9 UTSW 6 92,837,184 (GRCm39) missense probably damaging 0.99
R2376:Adamts9 UTSW 6 92,889,812 (GRCm39) missense probably benign
R2432:Adamts9 UTSW 6 92,834,881 (GRCm39) missense probably damaging 1.00
R2876:Adamts9 UTSW 6 92,772,891 (GRCm39) splice site probably benign
R3015:Adamts9 UTSW 6 92,849,913 (GRCm39) missense probably benign 0.05
R3611:Adamts9 UTSW 6 92,846,965 (GRCm39) missense probably benign 0.05
R4024:Adamts9 UTSW 6 92,849,765 (GRCm39) splice site probably benign
R4292:Adamts9 UTSW 6 92,772,977 (GRCm39) missense possibly damaging 0.95
R4403:Adamts9 UTSW 6 92,836,845 (GRCm39) missense probably damaging 1.00
R4574:Adamts9 UTSW 6 92,856,940 (GRCm39) nonsense probably null
R4677:Adamts9 UTSW 6 92,793,587 (GRCm39) start codon destroyed probably null
R5114:Adamts9 UTSW 6 92,867,254 (GRCm39) missense probably benign 0.03
R5260:Adamts9 UTSW 6 92,784,118 (GRCm39) missense probably benign 0.00
R5384:Adamts9 UTSW 6 92,774,999 (GRCm39) missense probably damaging 1.00
R5423:Adamts9 UTSW 6 92,857,678 (GRCm39) missense possibly damaging 0.84
R5497:Adamts9 UTSW 6 92,831,346 (GRCm39) missense probably damaging 1.00
R5629:Adamts9 UTSW 6 92,775,114 (GRCm39) missense probably damaging 1.00
R5943:Adamts9 UTSW 6 92,880,767 (GRCm39) missense probably benign 0.02
R6039:Adamts9 UTSW 6 92,885,527 (GRCm39) missense possibly damaging 0.95
R6039:Adamts9 UTSW 6 92,885,527 (GRCm39) missense possibly damaging 0.95
R6051:Adamts9 UTSW 6 92,867,099 (GRCm39) missense probably damaging 1.00
R6051:Adamts9 UTSW 6 92,836,907 (GRCm39) missense possibly damaging 0.83
R6082:Adamts9 UTSW 6 92,866,930 (GRCm39) missense probably damaging 1.00
R6192:Adamts9 UTSW 6 92,774,002 (GRCm39) missense probably damaging 1.00
R6291:Adamts9 UTSW 6 92,867,101 (GRCm39) missense probably damaging 1.00
R6502:Adamts9 UTSW 6 92,849,316 (GRCm39) missense probably damaging 1.00
R6818:Adamts9 UTSW 6 92,882,172 (GRCm39) missense probably damaging 1.00
R6848:Adamts9 UTSW 6 92,840,335 (GRCm39) missense possibly damaging 0.84
R7028:Adamts9 UTSW 6 92,886,774 (GRCm39) nonsense probably null
R7095:Adamts9 UTSW 6 92,864,672 (GRCm39) missense probably benign 0.39
R7287:Adamts9 UTSW 6 92,866,984 (GRCm39) missense possibly damaging 0.89
R7294:Adamts9 UTSW 6 92,871,270 (GRCm39) missense probably damaging 1.00
R7313:Adamts9 UTSW 6 92,835,102 (GRCm39) missense probably damaging 1.00
R7581:Adamts9 UTSW 6 92,914,319 (GRCm39) missense probably benign 0.00
R7682:Adamts9 UTSW 6 92,857,679 (GRCm39) missense possibly damaging 0.57
R7691:Adamts9 UTSW 6 92,773,219 (GRCm39) missense probably damaging 1.00
R7791:Adamts9 UTSW 6 92,849,366 (GRCm39) missense probably benign 0.00
R7851:Adamts9 UTSW 6 92,885,687 (GRCm39) missense probably damaging 1.00
R7974:Adamts9 UTSW 6 92,886,668 (GRCm39) critical splice donor site probably null
R8224:Adamts9 UTSW 6 92,773,351 (GRCm39) missense probably damaging 0.96
R8328:Adamts9 UTSW 6 92,866,993 (GRCm39) missense probably benign 0.17
R8334:Adamts9 UTSW 6 92,914,225 (GRCm39) splice site probably null
R8559:Adamts9 UTSW 6 92,784,117 (GRCm39) missense probably benign 0.01
R8709:Adamts9 UTSW 6 92,784,144 (GRCm39) missense probably damaging 1.00
R8735:Adamts9 UTSW 6 92,837,048 (GRCm39) intron probably benign
R8739:Adamts9 UTSW 6 92,831,261 (GRCm39) missense probably benign 0.04
R9108:Adamts9 UTSW 6 92,857,721 (GRCm39) missense probably damaging 1.00
R9171:Adamts9 UTSW 6 92,849,381 (GRCm39) missense probably benign 0.03
R9198:Adamts9 UTSW 6 92,837,170 (GRCm39) missense probably benign 0.35
R9299:Adamts9 UTSW 6 92,773,976 (GRCm39) missense probably benign 0.00
R9300:Adamts9 UTSW 6 92,864,371 (GRCm39) missense probably benign 0.10
R9308:Adamts9 UTSW 6 92,857,875 (GRCm39) missense probably benign 0.03
R9325:Adamts9 UTSW 6 92,849,279 (GRCm39) missense probably benign 0.00
R9397:Adamts9 UTSW 6 92,878,444 (GRCm39) missense probably damaging 1.00
R9550:Adamts9 UTSW 6 92,878,429 (GRCm39) missense probably benign 0.00
R9623:Adamts9 UTSW 6 92,857,661 (GRCm39) missense probably benign 0.02
R9698:Adamts9 UTSW 6 92,784,121 (GRCm39) missense probably damaging 1.00
R9755:Adamts9 UTSW 6 92,856,922 (GRCm39) missense probably benign 0.15
RF013:Adamts9 UTSW 6 92,920,126 (GRCm39) missense possibly damaging 0.88
Z1177:Adamts9 UTSW 6 92,831,327 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGACAGAATGGCATCCATGACC -3'
(R):5'- TACGCTGGGTTCCTAAGTACAG -3'

Sequencing Primer
(F):5'- GAATGGCATCCATGACCTATACCTTG -3'
(R):5'- CTGGGTTCCTAAGTACAGCGGAAG -3'
Posted On 2019-06-07