Incidental Mutation 'R0604:Clgn'
ID55592
Institutional Source Beutler Lab
Gene Symbol Clgn
Ensembl Gene ENSMUSG00000002190
Gene Namecalmegin
Synonyms4930459O04Rik, A2/6, Cln, calnexin-t
MMRRC Submission 038793-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.388) question?
Stock #R0604 (G1)
Quality Score143
Status Not validated
Chromosome8
Chromosomal Location83389867-83428552 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83424194 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 496 (V496A)
Ref Sequence ENSEMBL: ENSMUSP00000105457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002259] [ENSMUST00000109831]
Predicted Effect probably benign
Transcript: ENSMUST00000002259
AA Change: V496A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000002259
Gene: ENSMUSG00000002190
AA Change: V496A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Calreticulin 62 429 6.6e-160 PFAM
transmembrane domain 471 493 N/A INTRINSIC
low complexity region 516 533 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109831
AA Change: V496A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000105457
Gene: ENSMUSG00000002190
AA Change: V496A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Calreticulin 60 429 1.9e-154 PFAM
transmembrane domain 471 493 N/A INTRINSIC
low complexity region 516 533 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene belongs to the calreticulin family, which includes calreticulin, calnexin, and calmegin, and encodes a calcium-binding molecular chaperone specifically expressed in pachytene stage male germ cells. It is required for the proper folding of newly synthesized membrane proteins in the endoplasmic reticulum including those critical for sperm migration from the uterus into the oviduct and sperm adhesion to and penetration of the zona pellucida. This gene plays a key role in spermatogenesis and male infertility. Alternative splice variants exist for this gene. [provided by RefSeq, Jul 2016]
PHENOTYPE: Males homozygous for a targeted null mutation exhibit severely impaired fertility associated with an apparent defect in either sperm/zona pellucida binding and/or sperm transit to the oviduct. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik C A 2: 28,466,091 R60L possibly damaging Het
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Acap1 T C 11: 69,884,625 E302G probably benign Het
Adrb2 G A 18: 62,178,515 T413I possibly damaging Het
Aqr T C 2: 114,130,604 K725R probably benign Het
Braf A G 6: 39,623,697 I662T probably damaging Het
Ccdc178 A G 18: 22,067,443 S435P probably benign Het
Chd9 A G 8: 91,036,542 M2332V possibly damaging Het
Dnah17 A C 11: 118,121,471 S193R probably benign Het
Dntt A G 19: 41,053,149 E424G probably benign Het
Fam149a A G 8: 45,345,008 L492P probably damaging Het
Fetub T C 16: 22,935,660 Y126H possibly damaging Het
Fgfr3 A T 5: 33,732,782 Y96F probably damaging Het
Gm4952 A G 19: 12,624,672 E148G probably benign Het
Gucy2g T A 19: 55,203,087 L977F probably benign Het
Il1r1 T C 1: 40,282,246 V6A probably benign Het
Itsn2 C A 12: 4,658,189 Q832K probably benign Het
Lats1 T A 10: 7,712,661 F1014Y probably damaging Het
Mcc G A 18: 44,473,756 A536V probably damaging Het
Mtrf1 T C 14: 79,415,887 V334A possibly damaging Het
Olfr1179 T C 2: 88,402,383 T184A probably benign Het
Olfr325 T A 11: 58,581,348 M168K probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr50 T A 2: 36,794,107 Y290* probably null Het
Pard6g A G 18: 80,117,208 S179G probably damaging Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Psg27 A T 7: 18,557,072 V402D probably damaging Het
Rttn A G 18: 88,977,758 I222V probably damaging Het
Sp9 T A 2: 73,273,638 S179T probably benign Het
Tbc1d8 T A 1: 39,405,326 H184L probably damaging Het
Vmn1r69 A G 7: 10,580,654 V50A probably benign Het
Vmn2r58 A G 7: 41,860,576 F526L possibly damaging Het
Other mutations in Clgn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01729:Clgn APN 8 83397650 missense probably damaging 1.00
IGL02158:Clgn APN 8 83423136 missense probably damaging 1.00
IGL03077:Clgn APN 8 83424140 missense probably benign 0.05
PIT4260001:Clgn UTSW 8 83423124 missense probably damaging 0.99
R1728:Clgn UTSW 8 83423030 missense probably damaging 0.98
R1729:Clgn UTSW 8 83423030 missense probably damaging 0.98
R2059:Clgn UTSW 8 83399978 missense probably benign 0.01
R2182:Clgn UTSW 8 83410410 missense possibly damaging 0.80
R3821:Clgn UTSW 8 83420477 missense probably null 0.02
R4542:Clgn UTSW 8 83420209 missense probably damaging 1.00
R5097:Clgn UTSW 8 83410523 missense possibly damaging 0.90
R5677:Clgn UTSW 8 83409538 missense probably damaging 1.00
R5752:Clgn UTSW 8 83397041 missense probably damaging 0.99
R5802:Clgn UTSW 8 83425614 missense probably damaging 1.00
R6584:Clgn UTSW 8 83400036 missense probably benign 0.33
R7542:Clgn UTSW 8 83395545 missense possibly damaging 0.90
R7563:Clgn UTSW 8 83420556 missense probably damaging 1.00
R7819:Clgn UTSW 8 83408200 missense possibly damaging 0.87
RF022:Clgn UTSW 8 83425606 missense probably damaging 1.00
Z1177:Clgn UTSW 8 83397681 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TGAACCATTTGCCCACGACCAG -3'
(R):5'- TGAAATGGACAATGCGTGTCCTCTC -3'

Sequencing Primer
(F):5'- AGGTGTCTTTTTCAgtgtgtgtg -3'
(R):5'- tgttttgtttttttgtttgttttTGC -3'
Posted On2013-07-11