Incidental Mutation 'PIT4458001:Spata31'
ID555930
Institutional Source Beutler Lab
Gene Symbol Spata31
Ensembl Gene ENSMUSG00000056223
Gene Namespermatogenesis associated 31
Synonyms4930458L03Rik, Fam75a, Spata31a
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock #PIT4458001 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location64917406-64923194 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64921850 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 604 (H604R)
Ref Sequence ENSEMBL: ENSMUSP00000097025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070216] [ENSMUST00000221202]
Predicted Effect probably benign
Transcript: ENSMUST00000070216
AA Change: H604R

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000097025
Gene: ENSMUSG00000056223
AA Change: H604R

DomainStartEndE-ValueType
low complexity region 35 45 N/A INTRINSIC
low complexity region 91 106 N/A INTRINSIC
Pfam:FAM75 149 431 1.7e-83 PFAM
Pfam:FAM75 426 462 4.5e-9 PFAM
low complexity region 478 491 N/A INTRINSIC
low complexity region 544 555 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221202
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.8%
  • 10x: 85.3%
  • 20x: 73.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G T 11: 9,298,304 V2684L probably benign Het
Adamts9 T A 6: 92,889,905 I718F probably damaging Het
Adcyap1r1 A G 6: 55,478,082 D110G probably benign Het
Adgrd1 G A 5: 129,131,577 G281D probably damaging Het
Afg1l A T 10: 42,454,370 C100* probably null Het
Atp2a2 G A 5: 122,457,309 Q993* probably null Het
Baz1a A G 12: 54,930,310 M389T probably benign Het
Btnl4 T A 17: 34,474,268 M58L probably benign Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cpeb1 A T 7: 81,348,432 F533Y probably damaging Het
Ctnna1 T A 18: 35,175,126 N166K possibly damaging Het
Ecsit T C 9: 22,076,284 H153R probably damaging Het
Gbp8 T C 5: 105,015,089 K480E probably benign Het
Glyat A T 19: 12,648,009 T66S probably benign Het
Gm1110 T C 9: 26,880,828 Q632R probably benign Het
Gm12185 C T 11: 48,907,911 R585Q probably damaging Het
Gm17669 TAA TAAA 18: 67,562,749 probably null Het
Gm7489 A C 15: 53,885,799 E89A unknown Het
Grb7 C T 11: 98,453,829 Q353* probably null Het
Ifi207 G A 1: 173,735,172 T136I unknown Het
Ighv3-1 T C 12: 113,964,604 Y45C probably benign Het
Ing5 A G 1: 93,811,946 M92V possibly damaging Het
Ivl TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 3: 92,572,301 probably benign Het
Kdm6b A T 11: 69,399,952 D1630E unknown Het
Lmo7 C T 14: 101,887,487 Q583* probably null Het
Lrrc37a T C 11: 103,504,512 D29G probably benign Het
Mpdz G T 4: 81,419,026 A10D probably damaging Het
Myh4 A G 11: 67,240,995 M94V possibly damaging Het
Nectin2 A C 7: 19,738,327 L46V probably benign Het
Nynrin A T 14: 55,863,968 T365S probably benign Het
Olfr1225 A T 2: 89,170,633 I193K probably benign Het
Pde4b A C 4: 102,602,678 E570A probably damaging Het
Phf3 T C 1: 30,816,541 H988R probably damaging Het
Ppfia2 A G 10: 106,927,847 K1234E probably benign Het
Prl7c1 A T 13: 27,773,758 M233K probably benign Het
Prp2 C T 6: 132,600,547 P266S unknown Het
Ralgds T C 2: 28,542,474 L160P probably damaging Het
Rasa1 A T 13: 85,227,118 M664K possibly damaging Het
Ryr2 T C 13: 11,555,448 T4930A probably benign Het
Senp8 T C 9: 59,737,480 Y131C probably damaging Het
Sp100 A G 1: 85,708,116 I547M probably benign Het
Spata20 A G 11: 94,484,608 M120T probably damaging Het
Sycp1 A T 3: 102,934,833 S53T probably benign Het
Tgm1 T C 14: 55,712,565 D62G unknown Het
Trpm1 G C 7: 64,268,561 E1434Q possibly damaging Het
Tshb A T 3: 102,778,164 Y50N probably damaging Het
Wdr17 A T 8: 54,673,579 Y413* probably null Het
Zdhhc16 G A 19: 41,937,770 G55R possibly damaging Het
Other mutations in Spata31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Spata31 APN 13 64922788 nonsense probably null
IGL01143:Spata31 APN 13 64920816 nonsense probably null
IGL01321:Spata31 APN 13 64921754 missense probably benign 0.01
IGL01624:Spata31 APN 13 64921585 missense probably damaging 1.00
IGL01844:Spata31 APN 13 64921154 missense possibly damaging 0.49
IGL02259:Spata31 APN 13 64921483 missense possibly damaging 0.90
IGL02358:Spata31 APN 13 64921218 missense probably benign
IGL02377:Spata31 APN 13 64920380 missense probably damaging 0.98
IGL02723:Spata31 APN 13 64920649 missense probably benign 0.10
IGL03125:Spata31 APN 13 64920889 missense probably benign 0.09
IGL03343:Spata31 APN 13 64919773 missense probably benign 0.41
F5770:Spata31 UTSW 13 64921648 missense probably benign 0.18
IGL02991:Spata31 UTSW 13 64920719 missense probably benign 0.05
P0043:Spata31 UTSW 13 64921006 unclassified probably null
PIT4366001:Spata31 UTSW 13 64921505 nonsense probably null
PIT4687001:Spata31 UTSW 13 64921337 missense probably benign 0.02
R0042:Spata31 UTSW 13 64922563 missense probably benign 0.00
R0042:Spata31 UTSW 13 64922563 missense probably benign 0.00
R0064:Spata31 UTSW 13 64922098 missense probably damaging 0.98
R0064:Spata31 UTSW 13 64922098 missense probably damaging 0.98
R0639:Spata31 UTSW 13 64922213 missense probably benign 0.02
R1253:Spata31 UTSW 13 64922024 missense probably benign 0.23
R1536:Spata31 UTSW 13 64921382 missense probably damaging 1.00
R1656:Spata31 UTSW 13 64921139 missense probably benign
R1802:Spata31 UTSW 13 64922383 missense probably benign 0.01
R1813:Spata31 UTSW 13 64921798 missense probably benign 0.32
R1916:Spata31 UTSW 13 64922545 nonsense probably null
R1917:Spata31 UTSW 13 64920865 missense possibly damaging 0.92
R1933:Spata31 UTSW 13 64920610 missense probably benign 0.02
R2910:Spata31 UTSW 13 64920436 missense probably benign 0.12
R3750:Spata31 UTSW 13 64921743 missense probably benign 0.01
R3876:Spata31 UTSW 13 64920931 missense probably benign 0.03
R3980:Spata31 UTSW 13 64922654 missense probably benign 0.24
R4056:Spata31 UTSW 13 64921655 missense probably benign 0.00
R4300:Spata31 UTSW 13 64919761 missense probably benign 0.08
R4797:Spata31 UTSW 13 64922742 nonsense probably null
R4997:Spata31 UTSW 13 64919723 missense probably benign 0.00
R5185:Spata31 UTSW 13 64917526 missense possibly damaging 0.93
R5366:Spata31 UTSW 13 64920459 missense probably damaging 0.98
R5539:Spata31 UTSW 13 64922969 missense probably benign 0.00
R5704:Spata31 UTSW 13 64922041 missense probably benign 0.32
R5748:Spata31 UTSW 13 64920313 makesense probably null
R5834:Spata31 UTSW 13 64922666 missense probably benign 0.19
R5926:Spata31 UTSW 13 64920725 missense possibly damaging 0.82
R6476:Spata31 UTSW 13 64917642 missense possibly damaging 0.68
R6603:Spata31 UTSW 13 64922665 missense probably damaging 1.00
R6620:Spata31 UTSW 13 64919757 missense possibly damaging 0.68
R6965:Spata31 UTSW 13 64922834 missense possibly damaging 0.90
R7086:Spata31 UTSW 13 64922229 missense probably benign 0.02
R7140:Spata31 UTSW 13 64921099 missense probably benign
R7396:Spata31 UTSW 13 64920733 missense probably benign
R7545:Spata31 UTSW 13 64922545 nonsense probably null
R7575:Spata31 UTSW 13 64922912 missense unknown
R7607:Spata31 UTSW 13 64921592 missense probably damaging 1.00
R8024:Spata31 UTSW 13 64922804 missense probably benign 0.12
V7580:Spata31 UTSW 13 64921648 missense probably benign 0.18
V7581:Spata31 UTSW 13 64921648 missense probably benign 0.18
V7583:Spata31 UTSW 13 64921648 missense probably benign 0.18
Z1176:Spata31 UTSW 13 64921972 nonsense probably null
Z1177:Spata31 UTSW 13 64921972 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCACTTCTGTACATAGGACCAG -3'
(R):5'- TGGCTGGCCTGCTAATTCTG -3'

Sequencing Primer
(F):5'- TTCTGTACATAGGACCAGATCAGCAG -3'
(R):5'- GTGGAAACTCACTAACAACTTTTTCC -3'
Posted On2019-06-07