Incidental Mutation 'R0604:Lats1'
ID 55594
Institutional Source Beutler Lab
Gene Symbol Lats1
Ensembl Gene ENSMUSG00000040021
Gene Name large tumor suppressor
Synonyms
MMRRC Submission 038793-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.890) question?
Stock # R0604 (G1)
Quality Score 200
Status Not validated
Chromosome 10
Chromosomal Location 7681214-7716460 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 7712661 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 1014 (F1014Y)
Ref Sequence ENSEMBL: ENSMUSP00000151533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040043] [ENSMUST00000165952] [ENSMUST00000217931]
AlphaFold Q8BYR2
Predicted Effect probably damaging
Transcript: ENSMUST00000040043
AA Change: F1014Y

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000041915
Gene: ENSMUSG00000040021
AA Change: F1014Y

DomainStartEndE-ValueType
Pfam:UBA 101 138 7.4e-11 PFAM
low complexity region 228 267 N/A INTRINSIC
low complexity region 301 314 N/A INTRINSIC
low complexity region 371 379 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 554 559 N/A INTRINSIC
S_TKc 704 1009 7.3e-99 SMART
S_TK_X 1010 1081 1.2e-2 SMART
low complexity region 1102 1120 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165952
AA Change: F1014Y

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000132078
Gene: ENSMUSG00000040021
AA Change: F1014Y

DomainStartEndE-ValueType
Pfam:UBA 101 138 7.4e-11 PFAM
low complexity region 228 267 N/A INTRINSIC
low complexity region 301 314 N/A INTRINSIC
low complexity region 371 379 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 554 559 N/A INTRINSIC
S_TKc 704 1009 7.3e-99 SMART
S_TK_X 1010 1081 1.2e-2 SMART
low complexity region 1102 1120 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000217931
AA Change: F1014Y

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. Two protein-coding transcripts and one non-protein coding transcript have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high postnatal mortality, lack of mammary development, infertility, pituitary hyperplasia, reduced hormone levels, growth retardation, and susceptibility to sarcomas and ovarian stromal cell tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik C A 2: 28,466,091 R60L possibly damaging Het
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Acap1 T C 11: 69,884,625 E302G probably benign Het
Adrb2 G A 18: 62,178,515 T413I possibly damaging Het
Aqr T C 2: 114,130,604 K725R probably benign Het
Braf A G 6: 39,623,697 I662T probably damaging Het
Ccdc178 A G 18: 22,067,443 S435P probably benign Het
Chd9 A G 8: 91,036,542 M2332V possibly damaging Het
Clgn T C 8: 83,424,194 V496A probably benign Het
Dnah17 A C 11: 118,121,471 S193R probably benign Het
Dntt A G 19: 41,053,149 E424G probably benign Het
Fam149a A G 8: 45,345,008 L492P probably damaging Het
Fetub T C 16: 22,935,660 Y126H possibly damaging Het
Fgfr3 A T 5: 33,732,782 Y96F probably damaging Het
Gm4952 A G 19: 12,624,672 E148G probably benign Het
Gucy2g T A 19: 55,203,087 L977F probably benign Het
Il1r1 T C 1: 40,282,246 V6A probably benign Het
Itsn2 C A 12: 4,658,189 Q832K probably benign Het
Mcc G A 18: 44,473,756 A536V probably damaging Het
Mtrf1 T C 14: 79,415,887 V334A possibly damaging Het
Olfr1179 T C 2: 88,402,383 T184A probably benign Het
Olfr325 T A 11: 58,581,348 M168K probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr50 T A 2: 36,794,107 Y290* probably null Het
Pard6g A G 18: 80,117,208 S179G probably damaging Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Psg27 A T 7: 18,557,072 V402D probably damaging Het
Rttn A G 18: 88,977,758 I222V probably damaging Het
Sp9 T A 2: 73,273,638 S179T probably benign Het
Tbc1d8 T A 1: 39,405,326 H184L probably damaging Het
Vmn1r69 A G 7: 10,580,654 V50A probably benign Het
Vmn2r58 A G 7: 41,860,576 F526L possibly damaging Het
Other mutations in Lats1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Lats1 APN 10 7691566 missense probably damaging 0.99
IGL00595:Lats1 APN 10 7702305 missense probably benign 0.00
IGL00932:Lats1 APN 10 7712742 missense possibly damaging 0.69
IGL01019:Lats1 APN 10 7705671 missense probably damaging 1.00
IGL01380:Lats1 APN 10 7691780 missense possibly damaging 0.69
IGL01965:Lats1 APN 10 7701706 missense probably benign 0.10
IGL02027:Lats1 APN 10 7712948 missense probably benign
IGL02611:Lats1 APN 10 7705787 missense possibly damaging 0.91
IGL02997:Lats1 APN 10 7702254 missense possibly damaging 0.53
IGL03107:Lats1 APN 10 7712746 missense probably benign 0.15
I1329:Lats1 UTSW 10 7712802 missense probably benign 0.10
PIT4378001:Lats1 UTSW 10 7705605 missense probably damaging 1.00
R0153:Lats1 UTSW 10 7691575 missense probably damaging 1.00
R0568:Lats1 UTSW 10 7712528 missense possibly damaging 0.69
R0581:Lats1 UTSW 10 7702941 missense possibly damaging 0.67
R1681:Lats1 UTSW 10 7705914 missense probably damaging 0.99
R1694:Lats1 UTSW 10 7701945 missense probably benign 0.07
R1840:Lats1 UTSW 10 7710939 nonsense probably null
R1914:Lats1 UTSW 10 7710457 splice site probably benign
R2137:Lats1 UTSW 10 7701847 missense possibly damaging 0.71
R2317:Lats1 UTSW 10 7691776 nonsense probably null
R3863:Lats1 UTSW 10 7705746 missense probably damaging 1.00
R3864:Lats1 UTSW 10 7705746 missense probably damaging 1.00
R4597:Lats1 UTSW 10 7691746 missense probably benign 0.00
R4657:Lats1 UTSW 10 7705684 missense possibly damaging 0.82
R4658:Lats1 UTSW 10 7702729 missense probably benign
R4663:Lats1 UTSW 10 7712583 missense probably damaging 1.00
R4870:Lats1 UTSW 10 7705785 missense probably damaging 1.00
R5101:Lats1 UTSW 10 7712584 nonsense probably null
R5134:Lats1 UTSW 10 7691811 missense probably benign 0.34
R5150:Lats1 UTSW 10 7712651 missense probably benign
R5546:Lats1 UTSW 10 7705754 missense probably damaging 0.99
R5820:Lats1 UTSW 10 7705908 missense probably damaging 1.00
R6006:Lats1 UTSW 10 7705595 missense probably damaging 1.00
R6301:Lats1 UTSW 10 7703107 missense probably benign 0.01
R6544:Lats1 UTSW 10 7701670 missense possibly damaging 0.94
R6647:Lats1 UTSW 10 7697507 missense possibly damaging 0.81
R6874:Lats1 UTSW 10 7710851 missense probably damaging 1.00
R7328:Lats1 UTSW 10 7705547 missense possibly damaging 0.62
R7390:Lats1 UTSW 10 7702095 nonsense probably null
R7438:Lats1 UTSW 10 7712942 nonsense probably null
R7457:Lats1 UTSW 10 7710891 missense probably damaging 1.00
R7524:Lats1 UTSW 10 7701978 missense possibly damaging 0.89
R7593:Lats1 UTSW 10 7701712 missense probably damaging 1.00
R7736:Lats1 UTSW 10 7702364 missense probably damaging 1.00
R7884:Lats1 UTSW 10 7697526 nonsense probably null
R8166:Lats1 UTSW 10 7702116 missense probably benign
R8248:Lats1 UTSW 10 7705903 missense probably damaging 1.00
R8458:Lats1 UTSW 10 7710924 nonsense probably null
R8477:Lats1 UTSW 10 7705515 missense probably damaging 1.00
R8547:Lats1 UTSW 10 7712849 missense probably damaging 1.00
R9163:Lats1 UTSW 10 7702288 missense probably benign
R9441:Lats1 UTSW 10 7702917 missense probably damaging 0.96
R9673:Lats1 UTSW 10 7712623 missense probably benign 0.29
RF021:Lats1 UTSW 10 7710608 missense probably damaging 1.00
X0026:Lats1 UTSW 10 7710623 missense probably damaging 1.00
X0053:Lats1 UTSW 10 7691609 missense probably benign 0.00
Z1176:Lats1 UTSW 10 7705809 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTACCCGGCAGATCATTTAGAAAACC -3'
(R):5'- CAGACTGTTGTTCTGAGCCCTGTG -3'

Sequencing Primer
(F):5'- GTACAAAACCTGGGAAATTACTGTG -3'
(R):5'- TCTGAGCCCTGTGAATGAATG -3'
Posted On 2013-07-11