Incidental Mutation 'PIT4458001:Glyat'
ID 555940
Institutional Source Beutler Lab
Gene Symbol Glyat
Ensembl Gene ENSMUSG00000063683
Gene Name glycine-N-acyltransferase
Synonyms A330009E03Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # PIT4458001 (G1)
Quality Score 188.009
Status Not validated
Chromosome 19
Chromosomal Location 12610672-12629101 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 12625373 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 66 (T66S)
Ref Sequence ENSEMBL: ENSMUSP00000043308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044976] [ENSMUST00000119960]
AlphaFold Q91XE0
Predicted Effect probably benign
Transcript: ENSMUST00000044976
AA Change: T66S

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000043308
Gene: ENSMUSG00000063683
AA Change: T66S

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 206 1.9e-90 PFAM
Pfam:Gly_acyl_tr_C 207 295 2.8e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119960
AA Change: T32S

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000114002
Gene: ENSMUSG00000063683
AA Change: T32S

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 172 1.2e-91 PFAM
Pfam:Gly_acyl_tr_C 173 261 3.6e-46 PFAM
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.8%
  • 10x: 85.3%
  • 20x: 73.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The glycine-N-acyltransferase protein conjugates glycine with acyl-CoA substrates in the mitochondria. The protein is thought to be important in the detoxification of endogenous and xenobiotic acyl-CoA's. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G T 11: 9,248,304 (GRCm39) V2684L probably benign Het
Adamts9 T A 6: 92,866,886 (GRCm39) I718F probably damaging Het
Adcyap1r1 A G 6: 55,455,067 (GRCm39) D110G probably benign Het
Adgrd1 G A 5: 129,208,641 (GRCm39) G281D probably damaging Het
Afg1l A T 10: 42,330,366 (GRCm39) C100* probably null Het
Atp2a2 G A 5: 122,595,372 (GRCm39) Q993* probably null Het
Baz1a A G 12: 54,977,095 (GRCm39) M389T probably benign Het
Btnl4 T A 17: 34,693,242 (GRCm39) M58L probably benign Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,128,173 (GRCm39) probably benign Het
Cpeb1 A T 7: 80,998,180 (GRCm39) F533Y probably damaging Het
Ctnna1 T A 18: 35,308,179 (GRCm39) N166K possibly damaging Het
Ecsit T C 9: 21,987,580 (GRCm39) H153R probably damaging Het
Gbp8 T C 5: 105,162,955 (GRCm39) K480E probably benign Het
Gm1110 T C 9: 26,792,124 (GRCm39) Q632R probably benign Het
Gm12185 C T 11: 48,798,738 (GRCm39) R585Q probably damaging Het
Gm17669 TAA TAAA 18: 67,695,819 (GRCm39) probably null Het
Gm7489 A C 15: 53,749,195 (GRCm39) E89A unknown Het
Grb7 C T 11: 98,344,655 (GRCm39) Q353* probably null Het
Ifi207 G A 1: 173,562,738 (GRCm39) T136I unknown Het
Ighv3-1 T C 12: 113,928,224 (GRCm39) Y45C probably benign Het
Ing5 A G 1: 93,739,668 (GRCm39) M92V possibly damaging Het
Ivl TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 3: 92,479,608 (GRCm39) probably benign Het
Kdm6b A T 11: 69,290,778 (GRCm39) D1630E unknown Het
Lmo7 C T 14: 102,124,923 (GRCm39) Q583* probably null Het
Lrrc37a T C 11: 103,395,338 (GRCm39) D29G probably benign Het
Mpdz G T 4: 81,337,263 (GRCm39) A10D probably damaging Het
Myh4 A G 11: 67,131,821 (GRCm39) M94V possibly damaging Het
Nectin2 A C 7: 19,472,252 (GRCm39) L46V probably benign Het
Nynrin A T 14: 56,101,425 (GRCm39) T365S probably benign Het
Or4c120 A T 2: 89,000,977 (GRCm39) I193K probably benign Het
Pde4b A C 4: 102,459,875 (GRCm39) E570A probably damaging Het
Phf3 T C 1: 30,855,622 (GRCm39) H988R probably damaging Het
Ppfia2 A G 10: 106,763,708 (GRCm39) K1234E probably benign Het
Prl7c1 A T 13: 27,957,741 (GRCm39) M233K probably benign Het
Prp2 C T 6: 132,577,510 (GRCm39) P266S unknown Het
Ralgds T C 2: 28,432,486 (GRCm39) L160P probably damaging Het
Rasa1 A T 13: 85,375,237 (GRCm39) M664K possibly damaging Het
Ryr2 T C 13: 11,570,334 (GRCm39) T4930A probably benign Het
Senp8 T C 9: 59,644,763 (GRCm39) Y131C probably damaging Het
Sp100 A G 1: 85,635,837 (GRCm39) I547M probably benign Het
Spata20 A G 11: 94,375,434 (GRCm39) M120T probably damaging Het
Spata31 A G 13: 65,069,664 (GRCm39) H604R probably benign Het
Sycp1 A T 3: 102,842,149 (GRCm39) S53T probably benign Het
Tgm1 T C 14: 55,950,022 (GRCm39) D62G unknown Het
Trpm1 G C 7: 63,918,309 (GRCm39) E1434Q possibly damaging Het
Tshb A T 3: 102,685,480 (GRCm39) Y50N probably damaging Het
Wdr17 A T 8: 55,126,614 (GRCm39) Y413* probably null Het
Zdhhc16 G A 19: 41,926,209 (GRCm39) G55R possibly damaging Het
Other mutations in Glyat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Glyat APN 19 12,625,497 (GRCm39) splice site probably benign
IGL00766:Glyat APN 19 12,628,626 (GRCm39) missense probably benign 0.19
IGL01288:Glyat APN 19 12,627,719 (GRCm39) missense possibly damaging 0.56
IGL02296:Glyat APN 19 12,628,625 (GRCm39) missense probably damaging 0.99
R0416:Glyat UTSW 19 12,628,817 (GRCm39) missense possibly damaging 0.87
R1463:Glyat UTSW 19 12,625,467 (GRCm39) missense probably damaging 1.00
R1750:Glyat UTSW 19 12,623,679 (GRCm39) missense probably benign 0.01
R2416:Glyat UTSW 19 12,628,618 (GRCm39) missense possibly damaging 0.50
R2504:Glyat UTSW 19 12,628,762 (GRCm39) missense possibly damaging 0.82
R2960:Glyat UTSW 19 12,617,214 (GRCm39) missense probably damaging 1.00
R3958:Glyat UTSW 19 12,617,197 (GRCm39) missense probably benign 0.05
R4126:Glyat UTSW 19 12,628,843 (GRCm39) missense probably benign 0.03
R4561:Glyat UTSW 19 12,628,644 (GRCm39) missense possibly damaging 0.88
R4705:Glyat UTSW 19 12,628,661 (GRCm39) missense possibly damaging 0.68
R5062:Glyat UTSW 19 12,627,627 (GRCm39) missense probably damaging 1.00
R5490:Glyat UTSW 19 12,627,645 (GRCm39) missense probably benign 0.35
R7028:Glyat UTSW 19 12,627,723 (GRCm39) missense probably benign 0.00
R7044:Glyat UTSW 19 12,627,629 (GRCm39) missense probably benign 0.05
R7599:Glyat UTSW 19 12,617,172 (GRCm39) missense probably damaging 0.99
R9595:Glyat UTSW 19 12,623,728 (GRCm39) missense probably damaging 1.00
R9784:Glyat UTSW 19 12,628,844 (GRCm39) missense probably benign 0.00
Z1088:Glyat UTSW 19 12,625,373 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACTACCATCTCAATGTCTGTGCTC -3'
(R):5'- GCATGGAAACCTTGGGAGAC -3'

Sequencing Primer
(F):5'- TACACGTGGTGGCTTACAAC -3'
(R):5'- CAAGACACAGAAGGGAAAGGTTC -3'
Posted On 2019-06-07